ID: 1095040580

View in Genome Browser
Species Human (GRCh38)
Location 12:37435947-37435969
Sequence CCAAGGCTCTGCTGTCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095040573_1095040580 15 Left 1095040573 12:37435909-37435931 CCATTTCAAAATGCAAACTGTGT No data
Right 1095040580 12:37435947-37435969 CCAAGGCTCTGCTGTCTGAAGGG No data
1095040570_1095040580 29 Left 1095040570 12:37435895-37435917 CCTCTTCCCTGGGTCCATTTCAA No data
Right 1095040580 12:37435947-37435969 CCAAGGCTCTGCTGTCTGAAGGG No data
1095040572_1095040580 22 Left 1095040572 12:37435902-37435924 CCTGGGTCCATTTCAAAATGCAA No data
Right 1095040580 12:37435947-37435969 CCAAGGCTCTGCTGTCTGAAGGG No data
1095040571_1095040580 23 Left 1095040571 12:37435901-37435923 CCCTGGGTCCATTTCAAAATGCA No data
Right 1095040580 12:37435947-37435969 CCAAGGCTCTGCTGTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095040580 Original CRISPR CCAAGGCTCTGCTGTCTGAA GGG Intergenic
No off target data available for this crispr