ID: 1095040582

View in Genome Browser
Species Human (GRCh38)
Location 12:37435957-37435979
Sequence GCTGTCTGAAGGGGTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095040573_1095040582 25 Left 1095040573 12:37435909-37435931 CCATTTCAAAATGCAAACTGTGT No data
Right 1095040582 12:37435957-37435979 GCTGTCTGAAGGGGTGAGAATGG No data
1095040576_1095040582 -2 Left 1095040576 12:37435936-37435958 CCAAATGGTGCCCAAGGCTCTGC No data
Right 1095040582 12:37435957-37435979 GCTGTCTGAAGGGGTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095040582 Original CRISPR GCTGTCTGAAGGGGTGAGAA TGG Intergenic
No off target data available for this crispr