ID: 1095041121

View in Genome Browser
Species Human (GRCh38)
Location 12:37442107-37442129
Sequence CAGTAAAAGTATTTTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095041121_1095041122 5 Left 1095041121 12:37442107-37442129 CCAGACTCAAAATACTTTTACTG No data
Right 1095041122 12:37442135-37442157 ATTCCATGTCTTATTTACTGAGG No data
1095041121_1095041124 8 Left 1095041121 12:37442107-37442129 CCAGACTCAAAATACTTTTACTG No data
Right 1095041124 12:37442138-37442160 CCATGTCTTATTTACTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095041121 Original CRISPR CAGTAAAAGTATTTTGAGTC TGG (reversed) Intergenic
No off target data available for this crispr