ID: 1095042905

View in Genome Browser
Species Human (GRCh38)
Location 12:37463926-37463948
Sequence GAATCTCTAACTGGGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095042905_1095042908 17 Left 1095042905 12:37463926-37463948 CCAGTCAGCCCAGTTAGAGATTC No data
Right 1095042908 12:37463966-37463988 TTCTGTGAATGCATTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095042905 Original CRISPR GAATCTCTAACTGGGCTGAC TGG (reversed) Intergenic
No off target data available for this crispr