ID: 1095048067

View in Genome Browser
Species Human (GRCh38)
Location 12:37532650-37532672
Sequence TCATTGCCTCCCTTCATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095048067_1095048075 19 Left 1095048067 12:37532650-37532672 CCCAAGATGAAGGGAGGCAATGA No data
Right 1095048075 12:37532692-37532714 TTCTGCTGACATCTGCCTCTGGG No data
1095048067_1095048077 26 Left 1095048067 12:37532650-37532672 CCCAAGATGAAGGGAGGCAATGA No data
Right 1095048077 12:37532699-37532721 GACATCTGCCTCTGGGGTCTTGG No data
1095048067_1095048074 18 Left 1095048067 12:37532650-37532672 CCCAAGATGAAGGGAGGCAATGA No data
Right 1095048074 12:37532691-37532713 TTTCTGCTGACATCTGCCTCTGG No data
1095048067_1095048076 20 Left 1095048067 12:37532650-37532672 CCCAAGATGAAGGGAGGCAATGA No data
Right 1095048076 12:37532693-37532715 TCTGCTGACATCTGCCTCTGGGG No data
1095048067_1095048078 27 Left 1095048067 12:37532650-37532672 CCCAAGATGAAGGGAGGCAATGA No data
Right 1095048078 12:37532700-37532722 ACATCTGCCTCTGGGGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095048067 Original CRISPR TCATTGCCTCCCTTCATCTT GGG (reversed) Intergenic
No off target data available for this crispr