ID: 1095048068

View in Genome Browser
Species Human (GRCh38)
Location 12:37532651-37532673
Sequence CTCATTGCCTCCCTTCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095048068_1095048076 19 Left 1095048068 12:37532651-37532673 CCAAGATGAAGGGAGGCAATGAG No data
Right 1095048076 12:37532693-37532715 TCTGCTGACATCTGCCTCTGGGG No data
1095048068_1095048075 18 Left 1095048068 12:37532651-37532673 CCAAGATGAAGGGAGGCAATGAG No data
Right 1095048075 12:37532692-37532714 TTCTGCTGACATCTGCCTCTGGG No data
1095048068_1095048074 17 Left 1095048068 12:37532651-37532673 CCAAGATGAAGGGAGGCAATGAG No data
Right 1095048074 12:37532691-37532713 TTTCTGCTGACATCTGCCTCTGG No data
1095048068_1095048078 26 Left 1095048068 12:37532651-37532673 CCAAGATGAAGGGAGGCAATGAG No data
Right 1095048078 12:37532700-37532722 ACATCTGCCTCTGGGGTCTTGGG No data
1095048068_1095048077 25 Left 1095048068 12:37532651-37532673 CCAAGATGAAGGGAGGCAATGAG No data
Right 1095048077 12:37532699-37532721 GACATCTGCCTCTGGGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095048068 Original CRISPR CTCATTGCCTCCCTTCATCT TGG (reversed) Intergenic
No off target data available for this crispr