ID: 1095048072

View in Genome Browser
Species Human (GRCh38)
Location 12:37532683-37532705
Sequence AGATGTCAGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095048072_1095048077 -7 Left 1095048072 12:37532683-37532705 CCTGCCATTTTCTGCTGACATCT No data
Right 1095048077 12:37532699-37532721 GACATCTGCCTCTGGGGTCTTGG No data
1095048072_1095048080 12 Left 1095048072 12:37532683-37532705 CCTGCCATTTTCTGCTGACATCT No data
Right 1095048080 12:37532718-37532740 TTGGGTATGATTTCATCACCTGG No data
1095048072_1095048078 -6 Left 1095048072 12:37532683-37532705 CCTGCCATTTTCTGCTGACATCT No data
Right 1095048078 12:37532700-37532722 ACATCTGCCTCTGGGGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095048072 Original CRISPR AGATGTCAGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr