ID: 1095048077

View in Genome Browser
Species Human (GRCh38)
Location 12:37532699-37532721
Sequence GACATCTGCCTCTGGGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095048067_1095048077 26 Left 1095048067 12:37532650-37532672 CCCAAGATGAAGGGAGGCAATGA No data
Right 1095048077 12:37532699-37532721 GACATCTGCCTCTGGGGTCTTGG No data
1095048071_1095048077 -6 Left 1095048071 12:37532682-37532704 CCCTGCCATTTTCTGCTGACATC No data
Right 1095048077 12:37532699-37532721 GACATCTGCCTCTGGGGTCTTGG No data
1095048072_1095048077 -7 Left 1095048072 12:37532683-37532705 CCTGCCATTTTCTGCTGACATCT No data
Right 1095048077 12:37532699-37532721 GACATCTGCCTCTGGGGTCTTGG No data
1095048068_1095048077 25 Left 1095048068 12:37532651-37532673 CCAAGATGAAGGGAGGCAATGAG No data
Right 1095048077 12:37532699-37532721 GACATCTGCCTCTGGGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095048077 Original CRISPR GACATCTGCCTCTGGGGTCT TGG Intergenic
No off target data available for this crispr