ID: 1095048080

View in Genome Browser
Species Human (GRCh38)
Location 12:37532718-37532740
Sequence TTGGGTATGATTTCATCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095048071_1095048080 13 Left 1095048071 12:37532682-37532704 CCCTGCCATTTTCTGCTGACATC No data
Right 1095048080 12:37532718-37532740 TTGGGTATGATTTCATCACCTGG No data
1095048072_1095048080 12 Left 1095048072 12:37532683-37532705 CCTGCCATTTTCTGCTGACATCT No data
Right 1095048080 12:37532718-37532740 TTGGGTATGATTTCATCACCTGG No data
1095048073_1095048080 8 Left 1095048073 12:37532687-37532709 CCATTTTCTGCTGACATCTGCCT No data
Right 1095048080 12:37532718-37532740 TTGGGTATGATTTCATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095048080 Original CRISPR TTGGGTATGATTTCATCACC TGG Intergenic
No off target data available for this crispr