ID: 1095049260

View in Genome Browser
Species Human (GRCh38)
Location 12:37542283-37542305
Sequence GGGTGAAAACCATTGACAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095049260_1095049268 18 Left 1095049260 12:37542283-37542305 CCGGCTGTCAATGGTTTTCACCC 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1095049268 12:37542324-37542346 GTGAAGGCTTCAACTGCGTGAGG 0: 1
1: 0
2: 1
3: 4
4: 48
1095049260_1095049269 29 Left 1095049260 12:37542283-37542305 CCGGCTGTCAATGGTTTTCACCC 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1095049269 12:37542335-37542357 AACTGCGTGAGGAGATGCGTCGG 0: 1
1: 0
2: 1
3: 2
4: 60
1095049260_1095049262 -9 Left 1095049260 12:37542283-37542305 CCGGCTGTCAATGGTTTTCACCC 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1095049262 12:37542297-37542319 TTTTCACCCCGGTACCACTTTGG 0: 1
1: 1
2: 0
3: 11
4: 56
1095049260_1095049266 2 Left 1095049260 12:37542283-37542305 CCGGCTGTCAATGGTTTTCACCC 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1095049266 12:37542308-37542330 GTACCACTTTGGTTGTGTGAAGG 0: 1
1: 1
2: 1
3: 22
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095049260 Original CRISPR GGGTGAAAACCATTGACAGC CGG (reversed) Intergenic
900588753 1:3449136-3449158 GGCTGAAAACCAGTGACAGAGGG - Intergenic
900588954 1:3450860-3450882 GGCTGAAAACCAGGGACAGAGGG - Intergenic
900590899 1:3459376-3459398 GGGAGAAAACCATCTACAGTGGG + Intronic
902308092 1:15558726-15558748 GGATTGAAATCATTGACAGCAGG - Intronic
908234530 1:62137336-62137358 GGGGGAAACCCATTGGCAGAAGG + Intronic
912282121 1:108327222-108327244 GGGGGAAAACCATCGTCTGCAGG + Intergenic
917346404 1:174032565-174032587 GGGTGATAACCACTGACATAGGG + Intergenic
917931464 1:179825520-179825542 GAGTGAAAAACAGTGGCAGCTGG + Intergenic
917961762 1:180151197-180151219 TGATGAAAACCAGTGACAGCAGG - Intergenic
920204463 1:204281670-204281692 GGGTGACAGCCACTGGCAGCTGG - Intronic
924699470 1:246436777-246436799 TGGTGAAAACCCTTTACACCTGG - Intronic
1067556467 10:47276775-47276797 GGGTGGAAGCCATGGAAAGCTGG - Intergenic
1067988801 10:51184904-51184926 GGGAGAAACCTAGTGACAGCAGG + Intronic
1072969499 10:100005074-100005096 GATTGAAAACCATGGATAGCTGG + Intronic
1078615674 11:12863404-12863426 GGGTGAAAACAAGTAACAGCAGG + Intronic
1080689707 11:34546171-34546193 GGTTGAAAACCATTGAGCCCAGG - Intergenic
1081231945 11:40596112-40596134 AGATGAAAAACAATGACAGCTGG + Intronic
1086322545 11:85665121-85665143 GGGCGAAAACCACTGACTTCCGG - Intronic
1086839467 11:91667233-91667255 GGCTCAGAACCATTGCCAGCTGG - Intergenic
1087499090 11:98928802-98928824 TGGTGAAAACCCATGATAGCTGG + Intergenic
1088954782 11:114607477-114607499 GGGTGAACACCATTACCGGCTGG + Intergenic
1094832136 12:34305155-34305177 GGGTGCAAACCAGGGACACCAGG - Intergenic
1094833792 12:34312858-34312880 GGGTGTGAACCAGTGACACCAGG + Intergenic
1094837335 12:34328283-34328305 GGGTGCAAACCAGGGACATCAGG + Intergenic
1095049260 12:37542283-37542305 GGGTGAAAACCATTGACAGCCGG - Intergenic
1103058429 12:117839800-117839822 GTGAGAAAACCATTGAAACCTGG + Intronic
1104208180 12:126660897-126660919 GGGGGAAGACCATTAACAGAAGG + Intergenic
1108746577 13:53401549-53401571 GGTTTTTAACCATTGACAGCTGG - Intergenic
1113042007 13:106114475-106114497 GGTTTAAAACCACTGACAGGTGG - Intergenic
1115717879 14:36125717-36125739 GGGTGAGAAGCATTGCCACCTGG - Intergenic
1119542482 14:75449873-75449895 GGGTGACACCCATTTACAGCCGG - Intronic
1124083935 15:26528929-26528951 GAATGAAAACCACTGACAGGAGG + Intergenic
1126353789 15:47773152-47773174 GGTTGAAAAACATTTACAACTGG - Exonic
1128535748 15:68488953-68488975 GGGTGAATACAATTGACACAGGG + Intergenic
1130111756 15:80971190-80971212 AGCTGAAAGCCATTTACAGCAGG - Intronic
1132824351 16:1895960-1895982 GGAGGGAAACCATTGAGAGCAGG - Intergenic
1136185084 16:28583273-28583295 GGGTGAAAACCAATCACAAATGG - Intronic
1141194113 16:81846882-81846904 GGGGGAAAACCATACACATCTGG - Intronic
1142559522 17:801780-801802 GGCTGCAAATCATTGACAGTTGG - Intronic
1142737768 17:1912383-1912405 GGGTGAACAGCATTGCAAGCAGG + Intergenic
1143867940 17:9937596-9937618 GGGTGAGAACCATTCAAAGGAGG + Intronic
1145370250 17:22301564-22301586 CGGTGAAAACGATCGACAGCCGG - Intergenic
1145385657 17:22409971-22409993 CCGTGAAAACGATGGACAGCTGG - Intergenic
1148460414 17:47836481-47836503 GGCTGAAAACCTTGGAAAGCAGG - Intronic
1149423116 17:56529967-56529989 AGCTGAAAACCCTGGACAGCTGG - Intergenic
1153143715 18:2003819-2003841 AGGTGAAAACCAATGACCTCAGG + Intergenic
1154088975 18:11339063-11339085 GTGAGGAAACCACTGACAGCTGG + Intergenic
1155111833 18:22723272-22723294 GGGTGAAAACCATTTGGAGGTGG - Intergenic
1157516425 18:48314918-48314940 GAGGGAAACCCATTAACAGCCGG - Intronic
1158238821 18:55353123-55353145 GAGTGAAAACCTTTGCCACCAGG - Intronic
1160019718 18:75171149-75171171 CGGTGAAAACCTTTGGCAGAAGG - Intergenic
1160613101 18:80104365-80104387 TGGTGAAAAACGATGACAGCTGG - Intergenic
1161503778 19:4633033-4633055 GGGAGAAAACCACTCACAGAGGG - Intergenic
1163687106 19:18717872-18717894 GGGAGAAGGCCTTTGACAGCAGG + Intronic
1166908473 19:46133012-46133034 GGGAGAAAAGCATTGCCTGCAGG + Intergenic
1166957460 19:46474446-46474468 GGCTGAAATCCTTTGAAAGCTGG + Intergenic
1167958904 19:53090407-53090429 GGGTGAGAACCATGAACAGATGG - Intronic
929594189 2:43165816-43165838 TGGAGAAAACCAAGGACAGCTGG + Intergenic
929757568 2:44779958-44779980 GAGGGAAAACCACTAACAGCTGG - Intergenic
933811126 2:86033375-86033397 GGATGAAGACCACTTACAGCGGG + Intronic
937273747 2:120671353-120671375 GGGTGAGAAGGATTGCCAGCAGG + Intergenic
945764951 2:213964352-213964374 GGCTGAAAACAAGTGACATCAGG - Intronic
945844797 2:214931297-214931319 GGGTGAAGAGCATTCCCAGCAGG + Intergenic
948748686 2:240114496-240114518 GGGAGAAATTCATTCACAGCTGG - Intergenic
1169681556 20:8219925-8219947 GGTTGCAAACTATTGACAGGTGG + Intronic
1170141186 20:13126437-13126459 TGATGAAAACCATTGAAAGTTGG + Intronic
1171531727 20:25857657-25857679 CGGCGAAAACGATTGACAACCGG + Intronic
1171533568 20:25867566-25867588 CCGTGAAAACGATTGACAACCGG + Intronic
1171846812 20:30282425-30282447 GGGCGAAAATGATTGACAACCGG - Intergenic
1171847496 20:30285904-30285926 GGGCGAAAACGATTGACAACCGG + Intergenic
1172133836 20:32673959-32673981 GGGTTAGACCCATTGACAGTTGG - Intergenic
1173352890 20:42261267-42261289 GGGAGAAAGTCATTGACAACAGG - Intronic
1173527639 20:43745175-43745197 TGTTGAAGTCCATTGACAGCTGG + Intergenic
1175736256 20:61389694-61389716 GGGTGAGAACAATTGGCACCTGG + Intronic
1175940203 20:62534291-62534313 GGATGGAACCCACTGACAGCTGG + Intergenic
1176656414 21:9592168-9592190 CGGCGAAAACGATTGACAGCCGG + Intergenic
1183147203 22:36004378-36004400 GGGAGAAAACAAAGGACAGCAGG - Intronic
953505964 3:43485642-43485664 GGGTGAAGAACTTCGACAGCTGG - Intronic
954164178 3:48742883-48742905 GGGTTAGAAACATTCACAGCTGG + Intergenic
959270166 3:104197176-104197198 GGCTGCAAACCATTGACACTTGG + Intergenic
962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG + Intronic
965771135 3:172182164-172182186 GGGAGAAATCCTTTGTCAGCAGG + Intronic
967786413 3:193501612-193501634 GGGTGATAACAATTGACAATAGG + Intronic
968124299 3:196147049-196147071 GGTTGAAAATCATTGACATGAGG + Intergenic
972675240 4:41254194-41254216 AGGTTAAAACCATTGTCAGGTGG + Intergenic
978196312 4:105976297-105976319 TGGTGAAAACCCCTGACTGCTGG - Intronic
983772647 4:171570555-171570577 GGGTGAAAGCCATAAACACCTGG + Intergenic
986398139 5:7351081-7351103 GTGTGAAAACAATTGAGAGAAGG - Intergenic
989718434 5:44493738-44493760 GGGAGAAAACCATTGAAGACAGG - Intergenic
991648517 5:68826930-68826952 GGGAGAAAACCATTCACAATAGG + Intergenic
991905175 5:71502602-71502624 GGGTGAAAAAAATTGTCTGCAGG + Exonic
994738099 5:103582424-103582446 GTGTGCAAACCAATGACAACAGG - Intergenic
995620458 5:114020533-114020555 CGGTGAAAAGCTTTTACAGCAGG - Intergenic
998336355 5:141375675-141375697 GGGTGACAGCCAGCGACAGCGGG + Exonic
998928634 5:147155972-147155994 GTGTGAAAGCCATTTACCGCAGG - Intergenic
999493262 5:152072324-152072346 GGGTGCCAGGCATTGACAGCAGG - Intergenic
999526350 5:152410450-152410472 GGGTGACACCCATGGACAGAGGG + Intronic
1010642941 6:78353235-78353257 GGATGAACACTCTTGACAGCTGG + Intergenic
1011963660 6:93124242-93124264 GAGTCAAAAGCCTTGACAGCTGG + Intergenic
1014981318 6:127949442-127949464 GGGTGACAGCCACTGACAGGTGG + Intergenic
1016624817 6:146154396-146154418 GGGAGAAAACCACACACAGCTGG - Intronic
1018412533 6:163566650-163566672 GGGGAAAAAACATTAACAGCAGG - Intronic
1019835736 7:3381422-3381444 GGGGGCAAAGCAGTGACAGCGGG + Intronic
1020441060 7:8216919-8216941 GGGTGAAAAAAATTGCCTGCAGG - Intronic
1021253858 7:18365046-18365068 GTTTGAAAAACATTGACAGCTGG + Intronic
1021932294 7:25593800-25593822 GGGTAGAAAACAATGACAGCAGG - Intergenic
1022234761 7:28450628-28450650 GGGTGAAAACTTGTGACAGGTGG - Intronic
1023220741 7:37918414-37918436 GGGTGAAAAAGATTTTCAGCTGG + Intronic
1023345687 7:39269210-39269232 GGGTGAGAACCACTGACCCCAGG + Intronic
1023592697 7:41796295-41796317 GGGTAAGAATGATTGACAGCTGG + Intergenic
1023794817 7:43782917-43782939 GAGTGAAAACCAATTGCAGCAGG + Intronic
1025268295 7:57485646-57485668 CGGCGAAAACCATTCACAACCGG - Intergenic
1025284418 7:57650606-57650628 CGGCGAAAACAATTGACAACTGG + Intergenic
1025284862 7:57652961-57652983 CAGTGAAAACCACTGACAACCGG + Intergenic
1025301104 7:57820302-57820324 CGGTGAAAACGATTGACAACCGG - Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1027503451 7:78984495-78984517 GGGTGTAAACAATAGACAGGAGG - Intronic
1027721703 7:81750756-81750778 GGTTGAAAATCATTGACAAGGGG - Intronic
1028090643 7:86696470-86696492 GGGCTAAAACCAGTGTCAGCAGG - Intronic
1028266538 7:88733319-88733341 GAGTGAACATCAGTGACAGCTGG - Intergenic
1030209254 7:106980242-106980264 GGCTGCAAACCATTGAGAGAGGG + Intergenic
1035782075 8:2235628-2235650 GGGTGAAAACCATGCACACAGGG + Intergenic
1037658939 8:20910824-20910846 GGGTCAACCCCAATGACAGCAGG + Intergenic
1039909874 8:41817950-41817972 GGGTGCAGCCCATTGGCAGCTGG - Intronic
1041332125 8:56738275-56738297 GGGTGAGAACCAGTGACATTAGG + Intergenic
1042821637 8:72936315-72936337 GGGTGAAACCCAGAGACTGCAGG - Exonic
1046795123 8:118363357-118363379 GGATGAAGACCATTGACATGGGG - Intronic
1047625030 8:126647629-126647651 GGGCAAAAATCATTGACTGCTGG + Intergenic
1053052296 9:34971923-34971945 GGTTGAAAACCCATGGCAGCGGG - Intronic
1053534078 9:38908438-38908460 GGGAAAAAACGAATGACAGCAGG + Intergenic
1054172471 9:61854803-61854825 CGGCGAAAACGATTGACAGCCGG - Intronic
1054206302 9:62132857-62132879 GGGAAAAAACGAATGACAGCAGG + Intergenic
1054447326 9:65383814-65383836 CGGCGAAAACGATTGACAGCCGG - Intergenic
1054632055 9:67455489-67455511 GGGAAAAAACGAATGACAGCAGG - Intergenic
1054665069 9:67725998-67726020 CGGCGAAAACGATTGACAGCCGG + Intergenic
1055044853 9:71912952-71912974 GAGAGAAAATCATTGACAACAGG + Intronic
1056955204 9:91075691-91075713 GGGAGAAAACCAAAGCCAGCAGG + Intergenic
1057150617 9:92792980-92793002 GGGTGAAAATCAATGACAAATGG + Intergenic
1057229281 9:93309049-93309071 GTGTGAAAACCTAGGACAGCAGG - Intronic
1061603411 9:131688296-131688318 GAGTGTAAACCATTGACTGGAGG - Intronic
1061615898 9:131778689-131778711 GGGAAAAAACCAATGACAGAAGG - Intergenic
1203495454 Un_GL000224v1:147109-147131 GAGGGAAAAACATTCACAGCAGG - Intergenic
1203508079 Un_KI270741v1:89032-89054 GAGGGAAAAACATTCACAGCAGG - Intergenic
1203634129 Un_KI270750v1:95650-95672 CGGCGAAAACGATTGACAGCCGG + Intergenic
1190319086 X:49169255-49169277 GAGTGAAGGGCATTGACAGCAGG + Intergenic
1192229350 X:69254505-69254527 GGAAGAAACCCAATGACAGCTGG + Intergenic
1192832752 X:74767629-74767651 GGCTCAGAACCACTGACAGCTGG + Intronic
1198223285 X:134622481-134622503 GGCTGAAACACTTTGACAGCTGG + Intronic
1199759324 X:150893188-150893210 GGCTGAAAACCAGTCAAAGCAGG + Intronic