ID: 1095049688

View in Genome Browser
Species Human (GRCh38)
Location 12:37544811-37544833
Sequence CTCTGGACAAGCCACCGGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095049682_1095049688 0 Left 1095049682 12:37544788-37544810 CCCTGTTATGGGAACGCCGGCCT 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1095049688 12:37544811-37544833 CTCTGGACAAGCCACCGGTTCGG No data
1095049683_1095049688 -1 Left 1095049683 12:37544789-37544811 CCTGTTATGGGAACGCCGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1095049688 12:37544811-37544833 CTCTGGACAAGCCACCGGTTCGG No data
1095049678_1095049688 24 Left 1095049678 12:37544764-37544786 CCGGGAATGGGAGATGGCAACAA 0: 11
1: 43
2: 7
3: 19
4: 188
Right 1095049688 12:37544811-37544833 CTCTGGACAAGCCACCGGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095049688 Original CRISPR CTCTGGACAAGCCACCGGTT CGG Intergenic
No off target data available for this crispr