ID: 1095049945

View in Genome Browser
Species Human (GRCh38)
Location 12:37546285-37546307
Sequence TCATCTTCTTGAAGGTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095049945_1095049949 19 Left 1095049945 12:37546285-37546307 CCCACAGACCTTCAAGAAGATGA No data
Right 1095049949 12:37546327-37546349 TTGCCCTCATTCAGAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095049945 Original CRISPR TCATCTTCTTGAAGGTCTGT GGG (reversed) Intergenic