ID: 1095068828

View in Genome Browser
Species Human (GRCh38)
Location 12:37815115-37815137
Sequence TCTCAGATGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095068819_1095068828 16 Left 1095068819 12:37815076-37815098 CCCAGATGGGGTGGCTGCTGGGC 0: 41
1: 430
2: 1406
3: 4350
4: 4592
Right 1095068828 12:37815115-37815137 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1095068816_1095068828 24 Left 1095068816 12:37815068-37815090 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 1095068828 12:37815115-37815137 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1095068820_1095068828 15 Left 1095068820 12:37815077-37815099 CCAGATGGGGTGGCTGCTGGGCG 0: 44
1: 475
2: 1214
3: 1583
4: 2796
Right 1095068828 12:37815115-37815137 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095068828 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG Intergenic
Too many off-targets to display for this crispr