ID: 1095069029

View in Genome Browser
Species Human (GRCh38)
Location 12:37816289-37816311
Sequence TAAAAAAAAGTGGTTCCAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095069029_1095069040 28 Left 1095069029 12:37816289-37816311 CCGTTTGGAACCACTTTTTTTTA No data
Right 1095069040 12:37816340-37816362 TTTGAGTCTTATGGTGGGAAAGG No data
1095069029_1095069033 -1 Left 1095069029 12:37816289-37816311 CCGTTTGGAACCACTTTTTTTTA No data
Right 1095069033 12:37816311-37816333 AGAATCTGCAAAGGGATATTTGG No data
1095069029_1095069036 22 Left 1095069029 12:37816289-37816311 CCGTTTGGAACCACTTTTTTTTA No data
Right 1095069036 12:37816334-37816356 GAGCCCTTTGAGTCTTATGGTGG No data
1095069029_1095069035 19 Left 1095069029 12:37816289-37816311 CCGTTTGGAACCACTTTTTTTTA No data
Right 1095069035 12:37816331-37816353 TGGGAGCCCTTTGAGTCTTATGG No data
1095069029_1095069037 23 Left 1095069029 12:37816289-37816311 CCGTTTGGAACCACTTTTTTTTA No data
Right 1095069037 12:37816335-37816357 AGCCCTTTGAGTCTTATGGTGGG No data
1095069029_1095069031 -10 Left 1095069029 12:37816289-37816311 CCGTTTGGAACCACTTTTTTTTA No data
Right 1095069031 12:37816302-37816324 CTTTTTTTTAGAATCTGCAAAGG No data
1095069029_1095069032 -9 Left 1095069029 12:37816289-37816311 CCGTTTGGAACCACTTTTTTTTA No data
Right 1095069032 12:37816303-37816325 TTTTTTTTAGAATCTGCAAAGGG No data
1095069029_1095069034 0 Left 1095069029 12:37816289-37816311 CCGTTTGGAACCACTTTTTTTTA No data
Right 1095069034 12:37816312-37816334 GAATCTGCAAAGGGATATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095069029 Original CRISPR TAAAAAAAAGTGGTTCCAAA CGG (reversed) Intergenic