ID: 1095069030

View in Genome Browser
Species Human (GRCh38)
Location 12:37816299-37816321
Sequence TTGCAGATTCTAAAAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095069030_1095069035 9 Left 1095069030 12:37816299-37816321 CCACTTTTTTTTAGAATCTGCAA No data
Right 1095069035 12:37816331-37816353 TGGGAGCCCTTTGAGTCTTATGG No data
1095069030_1095069037 13 Left 1095069030 12:37816299-37816321 CCACTTTTTTTTAGAATCTGCAA No data
Right 1095069037 12:37816335-37816357 AGCCCTTTGAGTCTTATGGTGGG No data
1095069030_1095069036 12 Left 1095069030 12:37816299-37816321 CCACTTTTTTTTAGAATCTGCAA No data
Right 1095069036 12:37816334-37816356 GAGCCCTTTGAGTCTTATGGTGG No data
1095069030_1095069040 18 Left 1095069030 12:37816299-37816321 CCACTTTTTTTTAGAATCTGCAA No data
Right 1095069040 12:37816340-37816362 TTTGAGTCTTATGGTGGGAAAGG No data
1095069030_1095069034 -10 Left 1095069030 12:37816299-37816321 CCACTTTTTTTTAGAATCTGCAA No data
Right 1095069034 12:37816312-37816334 GAATCTGCAAAGGGATATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095069030 Original CRISPR TTGCAGATTCTAAAAAAAAG TGG (reversed) Intergenic