ID: 1095069034

View in Genome Browser
Species Human (GRCh38)
Location 12:37816312-37816334
Sequence GAATCTGCAAAGGGATATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095069030_1095069034 -10 Left 1095069030 12:37816299-37816321 CCACTTTTTTTTAGAATCTGCAA No data
Right 1095069034 12:37816312-37816334 GAATCTGCAAAGGGATATTTGGG No data
1095069027_1095069034 17 Left 1095069027 12:37816272-37816294 CCATTCTTTTGATGGAGCCGTTT No data
Right 1095069034 12:37816312-37816334 GAATCTGCAAAGGGATATTTGGG No data
1095069029_1095069034 0 Left 1095069029 12:37816289-37816311 CCGTTTGGAACCACTTTTTTTTA No data
Right 1095069034 12:37816312-37816334 GAATCTGCAAAGGGATATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095069034 Original CRISPR GAATCTGCAAAGGGATATTT GGG Intergenic