ID: 1095069035

View in Genome Browser
Species Human (GRCh38)
Location 12:37816331-37816353
Sequence TGGGAGCCCTTTGAGTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095069030_1095069035 9 Left 1095069030 12:37816299-37816321 CCACTTTTTTTTAGAATCTGCAA No data
Right 1095069035 12:37816331-37816353 TGGGAGCCCTTTGAGTCTTATGG No data
1095069029_1095069035 19 Left 1095069029 12:37816289-37816311 CCGTTTGGAACCACTTTTTTTTA No data
Right 1095069035 12:37816331-37816353 TGGGAGCCCTTTGAGTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095069035 Original CRISPR TGGGAGCCCTTTGAGTCTTA TGG Intergenic