ID: 1095069036 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:37816334-37816356 |
Sequence | GAGCCCTTTGAGTCTTATGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1095069029_1095069036 | 22 | Left | 1095069029 | 12:37816289-37816311 | CCGTTTGGAACCACTTTTTTTTA | No data | ||
Right | 1095069036 | 12:37816334-37816356 | GAGCCCTTTGAGTCTTATGGTGG | No data | ||||
1095069030_1095069036 | 12 | Left | 1095069030 | 12:37816299-37816321 | CCACTTTTTTTTAGAATCTGCAA | No data | ||
Right | 1095069036 | 12:37816334-37816356 | GAGCCCTTTGAGTCTTATGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1095069036 | Original CRISPR | GAGCCCTTTGAGTCTTATGG TGG | Intergenic | ||