ID: 1095086609

View in Genome Browser
Species Human (GRCh38)
Location 12:38063026-38063048
Sequence GCTCTAAGACAGAGCCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095086609_1095086612 20 Left 1095086609 12:38063026-38063048 CCCTCTGGGCTCTGTCTTAGAGC No data
Right 1095086612 12:38063069-38063091 AAGTTCTGCCGTCAAAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095086609 Original CRISPR GCTCTAAGACAGAGCCCAGA GGG (reversed) Intergenic
No off target data available for this crispr