ID: 1095090401

View in Genome Browser
Species Human (GRCh38)
Location 12:38099301-38099323
Sequence CCATGGCACATGTAAACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095090393_1095090401 14 Left 1095090393 12:38099264-38099286 CCTGAAGTCGGGAGTTCAAGATA No data
Right 1095090401 12:38099301-38099323 CCATGGCACATGTAAACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095090401 Original CRISPR CCATGGCACATGTAAACCTA TGG Intergenic
No off target data available for this crispr