ID: 1095091362

View in Genome Browser
Species Human (GRCh38)
Location 12:38109828-38109850
Sequence TCGGAGGATCACTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095091362_1095091364 -6 Left 1095091362 12:38109828-38109850 CCTGGGCTTCAGTGATCCTCCGA No data
Right 1095091364 12:38109845-38109867 CTCCGAAGTAGCTGTGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095091362 Original CRISPR TCGGAGGATCACTGAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr