ID: 1095091364

View in Genome Browser
Species Human (GRCh38)
Location 12:38109845-38109867
Sequence CTCCGAAGTAGCTGTGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095091360_1095091364 6 Left 1095091360 12:38109816-38109838 CCACTTCCGTCTCCTGGGCTTCA No data
Right 1095091364 12:38109845-38109867 CTCCGAAGTAGCTGTGACTATGG No data
1095091362_1095091364 -6 Left 1095091362 12:38109828-38109850 CCTGGGCTTCAGTGATCCTCCGA No data
Right 1095091364 12:38109845-38109867 CTCCGAAGTAGCTGTGACTATGG No data
1095091361_1095091364 0 Left 1095091361 12:38109822-38109844 CCGTCTCCTGGGCTTCAGTGATC No data
Right 1095091364 12:38109845-38109867 CTCCGAAGTAGCTGTGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095091364 Original CRISPR CTCCGAAGTAGCTGTGACTA TGG Intergenic
No off target data available for this crispr