ID: 1095094430

View in Genome Browser
Species Human (GRCh38)
Location 12:38138238-38138260
Sequence CCGCTCATGCCCACCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095094419_1095094430 11 Left 1095094419 12:38138204-38138226 CCTCCTGTTGCCCCTGGGGACCT No data
Right 1095094430 12:38138238-38138260 CCGCTCATGCCCACCCGCCCCGG No data
1095094420_1095094430 8 Left 1095094420 12:38138207-38138229 CCTGTTGCCCCTGGGGACCTCGT No data
Right 1095094430 12:38138238-38138260 CCGCTCATGCCCACCCGCCCCGG No data
1095094421_1095094430 1 Left 1095094421 12:38138214-38138236 CCCCTGGGGACCTCGTTCCCTGG No data
Right 1095094430 12:38138238-38138260 CCGCTCATGCCCACCCGCCCCGG No data
1095094418_1095094430 12 Left 1095094418 12:38138203-38138225 CCCTCCTGTTGCCCCTGGGGACC No data
Right 1095094430 12:38138238-38138260 CCGCTCATGCCCACCCGCCCCGG No data
1095094423_1095094430 0 Left 1095094423 12:38138215-38138237 CCCTGGGGACCTCGTTCCCTGGC No data
Right 1095094430 12:38138238-38138260 CCGCTCATGCCCACCCGCCCCGG No data
1095094416_1095094430 15 Left 1095094416 12:38138200-38138222 CCTCCCTCCTGTTGCCCCTGGGG No data
Right 1095094430 12:38138238-38138260 CCGCTCATGCCCACCCGCCCCGG No data
1095094425_1095094430 -9 Left 1095094425 12:38138224-38138246 CCTCGTTCCCTGGCCCGCTCATG No data
Right 1095094430 12:38138238-38138260 CCGCTCATGCCCACCCGCCCCGG No data
1095094424_1095094430 -1 Left 1095094424 12:38138216-38138238 CCTGGGGACCTCGTTCCCTGGCC No data
Right 1095094430 12:38138238-38138260 CCGCTCATGCCCACCCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095094430 Original CRISPR CCGCTCATGCCCACCCGCCC CGG Intergenic
No off target data available for this crispr