ID: 1095095091

View in Genome Browser
Species Human (GRCh38)
Location 12:38143030-38143052
Sequence GTCCCCACAACTAATAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095095091_1095095094 -6 Left 1095095091 12:38143030-38143052 CCTGGTCTATTAGTTGTGGGGAC No data
Right 1095095094 12:38143047-38143069 GGGGACTGCCTGGGAGAGCGTGG No data
1095095091_1095095096 12 Left 1095095091 12:38143030-38143052 CCTGGTCTATTAGTTGTGGGGAC No data
Right 1095095096 12:38143065-38143087 CGTGGTGACCCACTGTACTGTGG No data
1095095091_1095095097 13 Left 1095095091 12:38143030-38143052 CCTGGTCTATTAGTTGTGGGGAC No data
Right 1095095097 12:38143066-38143088 GTGGTGACCCACTGTACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095095091 Original CRISPR GTCCCCACAACTAATAGACC AGG (reversed) Intergenic
No off target data available for this crispr