ID: 1095095366

View in Genome Browser
Species Human (GRCh38)
Location 12:38145008-38145030
Sequence GCCAGTGGGTACCCCGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095095366_1095095370 -9 Left 1095095366 12:38145008-38145030 CCGGACTCGGGGTACCCACTGGC No data
Right 1095095370 12:38145022-38145044 CCCACTGGCTGGTGCAAGGCTGG No data
1095095366_1095095372 14 Left 1095095366 12:38145008-38145030 CCGGACTCGGGGTACCCACTGGC No data
Right 1095095372 12:38145045-38145067 TTTCCCCACACAAAGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095095366 Original CRISPR GCCAGTGGGTACCCCGAGTC CGG (reversed) Intergenic
No off target data available for this crispr