ID: 1095095414

View in Genome Browser
Species Human (GRCh38)
Location 12:38145375-38145397
Sequence GGTTATCTGCAGATAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095095410_1095095414 18 Left 1095095410 12:38145334-38145356 CCAGAGGCTAGCTGAGAGAGCCT No data
Right 1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG No data
1095095411_1095095414 -2 Left 1095095411 12:38145354-38145376 CCTGTCGCTCAAAAGAAGAATGG No data
Right 1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095095414 Original CRISPR GGTTATCTGCAGATAATGGC AGG Intergenic
No off target data available for this crispr