ID: 1095096221

View in Genome Browser
Species Human (GRCh38)
Location 12:38150793-38150815
Sequence CTTGGCTTCTAGAAGATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095096215_1095096221 1 Left 1095096215 12:38150769-38150791 CCTCGCTGCCCTCACACCTTGTG No data
Right 1095096221 12:38150793-38150815 CTTGGCTTCTAGAAGATTGATGG No data
1095096217_1095096221 -7 Left 1095096217 12:38150777-38150799 CCCTCACACCTTGTGCCTTGGCT No data
Right 1095096221 12:38150793-38150815 CTTGGCTTCTAGAAGATTGATGG No data
1095096218_1095096221 -8 Left 1095096218 12:38150778-38150800 CCTCACACCTTGTGCCTTGGCTT No data
Right 1095096221 12:38150793-38150815 CTTGGCTTCTAGAAGATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095096221 Original CRISPR CTTGGCTTCTAGAAGATTGA TGG Intergenic
No off target data available for this crispr