ID: 1095097198

View in Genome Browser
Species Human (GRCh38)
Location 12:38155067-38155089
Sequence CTGCTTTGGGGTGTCCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095097198_1095097205 -6 Left 1095097198 12:38155067-38155089 CCATGAGGGACACCCCAAAGCAG No data
Right 1095097205 12:38155084-38155106 AAGCAGCAAGAAGGCCTCCGGGG No data
1095097198_1095097207 -1 Left 1095097198 12:38155067-38155089 CCATGAGGGACACCCCAAAGCAG No data
Right 1095097207 12:38155089-38155111 GCAAGAAGGCCTCCGGGGGAAGG No data
1095097198_1095097203 -8 Left 1095097198 12:38155067-38155089 CCATGAGGGACACCCCAAAGCAG No data
Right 1095097203 12:38155082-38155104 CAAAGCAGCAAGAAGGCCTCCGG No data
1095097198_1095097206 -5 Left 1095097198 12:38155067-38155089 CCATGAGGGACACCCCAAAGCAG No data
Right 1095097206 12:38155085-38155107 AGCAGCAAGAAGGCCTCCGGGGG No data
1095097198_1095097204 -7 Left 1095097198 12:38155067-38155089 CCATGAGGGACACCCCAAAGCAG No data
Right 1095097204 12:38155083-38155105 AAAGCAGCAAGAAGGCCTCCGGG No data
1095097198_1095097208 0 Left 1095097198 12:38155067-38155089 CCATGAGGGACACCCCAAAGCAG No data
Right 1095097208 12:38155090-38155112 CAAGAAGGCCTCCGGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095097198 Original CRISPR CTGCTTTGGGGTGTCCCTCA TGG (reversed) Intergenic
No off target data available for this crispr