ID: 1095098519

View in Genome Browser
Species Human (GRCh38)
Location 12:38160270-38160292
Sequence TTGTGTGTCTCGCCCACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095098513_1095098519 -6 Left 1095098513 12:38160253-38160275 CCTGGCTTGCACCCAGGTTGTGT No data
Right 1095098519 12:38160270-38160292 TTGTGTGTCTCGCCCACAGGGGG No data
1095098502_1095098519 30 Left 1095098502 12:38160217-38160239 CCACCCCTGCGCCGGGCCAGGGA No data
Right 1095098519 12:38160270-38160292 TTGTGTGTCTCGCCCACAGGGGG No data
1095098505_1095098519 26 Left 1095098505 12:38160221-38160243 CCCTGCGCCGGGCCAGGGATGGT No data
Right 1095098519 12:38160270-38160292 TTGTGTGTCTCGCCCACAGGGGG No data
1095098503_1095098519 27 Left 1095098503 12:38160220-38160242 CCCCTGCGCCGGGCCAGGGATGG No data
Right 1095098519 12:38160270-38160292 TTGTGTGTCTCGCCCACAGGGGG No data
1095098512_1095098519 -5 Left 1095098512 12:38160252-38160274 CCCTGGCTTGCACCCAGGTTGTG No data
Right 1095098519 12:38160270-38160292 TTGTGTGTCTCGCCCACAGGGGG No data
1095098508_1095098519 19 Left 1095098508 12:38160228-38160250 CCGGGCCAGGGATGGTCGCGGAG No data
Right 1095098519 12:38160270-38160292 TTGTGTGTCTCGCCCACAGGGGG No data
1095098509_1095098519 14 Left 1095098509 12:38160233-38160255 CCAGGGATGGTCGCGGAGTCCCT No data
Right 1095098519 12:38160270-38160292 TTGTGTGTCTCGCCCACAGGGGG No data
1095098506_1095098519 25 Left 1095098506 12:38160222-38160244 CCTGCGCCGGGCCAGGGATGGTC No data
Right 1095098519 12:38160270-38160292 TTGTGTGTCTCGCCCACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095098519 Original CRISPR TTGTGTGTCTCGCCCACAGG GGG Intergenic
No off target data available for this crispr