ID: 1095098626

View in Genome Browser
Species Human (GRCh38)
Location 12:38160723-38160745
Sequence GTGCGTGTCTCGCCCTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095098626_1095098630 -6 Left 1095098626 12:38160723-38160745 CCCCCTGAGGGCGAGACACGCAC No data
Right 1095098630 12:38160740-38160762 ACGCACCCTGTGTGCAAGACAGG No data
1095098626_1095098631 -5 Left 1095098626 12:38160723-38160745 CCCCCTGAGGGCGAGACACGCAC No data
Right 1095098631 12:38160741-38160763 CGCACCCTGTGTGCAAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095098626 Original CRISPR GTGCGTGTCTCGCCCTCAGG GGG (reversed) Intergenic
No off target data available for this crispr