ID: 1095101001

View in Genome Browser
Species Human (GRCh38)
Location 12:38183868-38183890
Sequence GCTGCTGCTGGGTGGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095101001_1095101013 30 Left 1095101001 12:38183868-38183890 CCCACCCCCCACCCAGCAGCAGC No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095101001 Original CRISPR GCTGCTGCTGGGTGGGGGGT GGG (reversed) Intergenic