ID: 1095101005 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:38183874-38183896 |
Sequence | CTTGTGGCTGCTGCTGGGTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1095101005_1095101014 | 27 | Left | 1095101005 | 12:38183874-38183896 | CCCCACCCAGCAGCAGCCACAAG | No data | ||
Right | 1095101014 | 12:38183924-38183946 | AGAGAGAGCACAGTGACTGGAGG | No data | ||||
1095101005_1095101013 | 24 | Left | 1095101005 | 12:38183874-38183896 | CCCCACCCAGCAGCAGCCACAAG | No data | ||
Right | 1095101013 | 12:38183921-38183943 | GAGAGAGAGAGCACAGTGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1095101005 | Original CRISPR | CTTGTGGCTGCTGCTGGGTG GGG (reversed) | Intergenic | ||