ID: 1095101007 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:38183876-38183898 |
| Sequence | GGCTTGTGGCTGCTGCTGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1095101007_1095101013 | 22 | Left | 1095101007 | 12:38183876-38183898 | CCACCCAGCAGCAGCCACAAGCC | No data | ||
| Right | 1095101013 | 12:38183921-38183943 | GAGAGAGAGAGCACAGTGACTGG | No data | ||||
| 1095101007_1095101014 | 25 | Left | 1095101007 | 12:38183876-38183898 | CCACCCAGCAGCAGCCACAAGCC | No data | ||
| Right | 1095101014 | 12:38183924-38183946 | AGAGAGAGCACAGTGACTGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1095101007 | Original CRISPR | GGCTTGTGGCTGCTGCTGGG TGG (reversed) | Intergenic | ||