ID: 1095101007

View in Genome Browser
Species Human (GRCh38)
Location 12:38183876-38183898
Sequence GGCTTGTGGCTGCTGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095101007_1095101013 22 Left 1095101007 12:38183876-38183898 CCACCCAGCAGCAGCCACAAGCC No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101007_1095101014 25 Left 1095101007 12:38183876-38183898 CCACCCAGCAGCAGCCACAAGCC No data
Right 1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095101007 Original CRISPR GGCTTGTGGCTGCTGCTGGG TGG (reversed) Intergenic