ID: 1095101008

View in Genome Browser
Species Human (GRCh38)
Location 12:38183879-38183901
Sequence TGTGGCTTGTGGCTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095101008_1095101014 22 Left 1095101008 12:38183879-38183901 CCCAGCAGCAGCCACAAGCCACA No data
Right 1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG No data
1095101008_1095101013 19 Left 1095101008 12:38183879-38183901 CCCAGCAGCAGCCACAAGCCACA No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095101008 Original CRISPR TGTGGCTTGTGGCTGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr