ID: 1095101010

View in Genome Browser
Species Human (GRCh38)
Location 12:38183890-38183912
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095101010_1095101014 11 Left 1095101010 12:38183890-38183912 CCACAAGCCACAGAGAAACCTGT No data
Right 1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG No data
1095101010_1095101013 8 Left 1095101010 12:38183890-38183912 CCACAAGCCACAGAGAAACCTGT No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095101010 Original CRISPR ACAGGTTTCTCTGTGGCTTG TGG (reversed) Intergenic