ID: 1095101012 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:38183908-38183930 |
Sequence | TCTCTCTCTCACAAATTCAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1095101012_1095101014 | -7 | Left | 1095101012 | 12:38183908-38183930 | CCTGTGAATTTGTGAGAGAGAGA | No data | ||
Right | 1095101014 | 12:38183924-38183946 | AGAGAGAGCACAGTGACTGGAGG | No data | ||||
1095101012_1095101013 | -10 | Left | 1095101012 | 12:38183908-38183930 | CCTGTGAATTTGTGAGAGAGAGA | No data | ||
Right | 1095101013 | 12:38183921-38183943 | GAGAGAGAGAGCACAGTGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1095101012 | Original CRISPR | TCTCTCTCTCACAAATTCAC AGG (reversed) | Intergenic | ||