ID: 1095101012

View in Genome Browser
Species Human (GRCh38)
Location 12:38183908-38183930
Sequence TCTCTCTCTCACAAATTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095101012_1095101014 -7 Left 1095101012 12:38183908-38183930 CCTGTGAATTTGTGAGAGAGAGA No data
Right 1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG No data
1095101012_1095101013 -10 Left 1095101012 12:38183908-38183930 CCTGTGAATTTGTGAGAGAGAGA No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095101012 Original CRISPR TCTCTCTCTCACAAATTCAC AGG (reversed) Intergenic