ID: 1095101013

View in Genome Browser
Species Human (GRCh38)
Location 12:38183921-38183943
Sequence GAGAGAGAGAGCACAGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095101009_1095101013 18 Left 1095101009 12:38183880-38183902 CCAGCAGCAGCCACAAGCCACAG No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101007_1095101013 22 Left 1095101007 12:38183876-38183898 CCACCCAGCAGCAGCCACAAGCC No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101003_1095101013 26 Left 1095101003 12:38183872-38183894 CCCCCCACCCAGCAGCAGCCACA No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101002_1095101013 29 Left 1095101002 12:38183869-38183891 CCACCCCCCACCCAGCAGCAGCC No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101006_1095101013 23 Left 1095101006 12:38183875-38183897 CCCACCCAGCAGCAGCCACAAGC No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101008_1095101013 19 Left 1095101008 12:38183879-38183901 CCCAGCAGCAGCCACAAGCCACA No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101012_1095101013 -10 Left 1095101012 12:38183908-38183930 CCTGTGAATTTGTGAGAGAGAGA No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101005_1095101013 24 Left 1095101005 12:38183874-38183896 CCCCACCCAGCAGCAGCCACAAG No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101004_1095101013 25 Left 1095101004 12:38183873-38183895 CCCCCACCCAGCAGCAGCCACAA No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101011_1095101013 1 Left 1095101011 12:38183897-38183919 CCACAGAGAAACCTGTGAATTTG No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101001_1095101013 30 Left 1095101001 12:38183868-38183890 CCCACCCCCCACCCAGCAGCAGC No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data
1095101010_1095101013 8 Left 1095101010 12:38183890-38183912 CCACAAGCCACAGAGAAACCTGT No data
Right 1095101013 12:38183921-38183943 GAGAGAGAGAGCACAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095101013 Original CRISPR GAGAGAGAGAGCACAGTGAC TGG Intergenic
No off target data available for this crispr