ID: 1095108085

View in Genome Browser
Species Human (GRCh38)
Location 12:38259558-38259580
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095108077_1095108085 12 Left 1095108077 12:38259523-38259545 CCAATCAGTGCTCTGTAAAATGG 0: 173
1: 372
2: 2244
3: 1788
4: 2239
Right 1095108085 12:38259558-38259580 GATGTTGGTGGGCCAAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095108085 Original CRISPR GATGTTGGTGGGCCAAATAA GGG Intergenic
No off target data available for this crispr