ID: 1095109679

View in Genome Browser
Species Human (GRCh38)
Location 12:38279282-38279304
Sequence ATGAACACACAGATGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095109679_1095109682 -8 Left 1095109679 12:38279282-38279304 CCACCTTTCATCTGTGTGTTCAT No data
Right 1095109682 12:38279297-38279319 GTGTTCATATGATCTTCTGTGGG No data
1095109679_1095109681 -9 Left 1095109679 12:38279282-38279304 CCACCTTTCATCTGTGTGTTCAT No data
Right 1095109681 12:38279296-38279318 TGTGTTCATATGATCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095109679 Original CRISPR ATGAACACACAGATGAAAGG TGG (reversed) Intergenic
No off target data available for this crispr