ID: 1095112867

View in Genome Browser
Species Human (GRCh38)
Location 12:38317086-38317108
Sequence CACCCCAGGAGAGGCCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 1, 2: 7, 3: 17, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095112855_1095112867 9 Left 1095112855 12:38317054-38317076 CCCTTTCCCAGGTGGGGTGCCCA 0: 1
1: 1
2: 0
3: 26
4: 262
Right 1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG 0: 1
1: 1
2: 7
3: 17
4: 240
1095112858_1095112867 2 Left 1095112858 12:38317061-38317083 CCAGGTGGGGTGCCCAACCTGTC 0: 1
1: 1
2: 0
3: 10
4: 87
Right 1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG 0: 1
1: 1
2: 7
3: 17
4: 240
1095112856_1095112867 8 Left 1095112856 12:38317055-38317077 CCTTTCCCAGGTGGGGTGCCCAA 0: 1
1: 1
2: 1
3: 16
4: 149
Right 1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG 0: 1
1: 1
2: 7
3: 17
4: 240
1095112851_1095112867 17 Left 1095112851 12:38317046-38317068 CCATTTCTCCCTTTCCCAGGTGG 0: 2
1: 0
2: 3
3: 59
4: 421
Right 1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG 0: 1
1: 1
2: 7
3: 17
4: 240
1095112860_1095112867 -10 Left 1095112860 12:38317073-38317095 CCCAACCTGTCCCCACCCCAGGA 0: 2
1: 0
2: 3
3: 62
4: 517
Right 1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG 0: 1
1: 1
2: 7
3: 17
4: 240
1095112857_1095112867 3 Left 1095112857 12:38317060-38317082 CCCAGGTGGGGTGCCCAACCTGT 0: 1
1: 1
2: 0
3: 5
4: 120
Right 1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG 0: 1
1: 1
2: 7
3: 17
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095112867 Original CRISPR CACCCCAGGAGAGGCCTGAA AGG Intronic
900283633 1:1888887-1888909 CTCCCCAGGGTAGGACTGAATGG - Intronic
900325895 1:2108494-2108516 CAGCCCAGGACAGACCTGGACGG - Intronic
900412472 1:2519037-2519059 CACCCCCAGGGAGGCCTGGAGGG - Intronic
900477460 1:2882609-2882631 CAACCCAGCAGAGGCCTCATAGG - Intergenic
901027604 1:6286893-6286915 CACCGCTGGAGAGGCTTGCAGGG + Intronic
902041897 1:13498742-13498764 CACCCCAGGAAACACCTGCAGGG - Intronic
903280083 1:22245341-22245363 CACCCCAGGAGGGGCCCTGAAGG - Intergenic
903492928 1:23743374-23743396 CACCCCAGCCGAGGCCCGGAAGG + Exonic
904334102 1:29785819-29785841 CTCCCCAGCAGGGGCCTGAGAGG - Intergenic
904670130 1:32158354-32158376 CATTACAGGTGAGGCCTGAAGGG + Exonic
905335621 1:37242754-37242776 CCCGAAAGGAGAGGCCTGAATGG + Intergenic
905522610 1:38612147-38612169 TCCCCCAGGTGAGGCCTGAAGGG - Intergenic
906099897 1:43253550-43253572 CACACCTGGAGAGGCACGAAGGG + Intronic
906988166 1:50709236-50709258 AACCCAAGTAGAGGCCTGAAAGG - Intronic
909836953 1:80267684-80267706 GACCCCAGTGGATGCCTGAAGGG + Intergenic
912384802 1:109265972-109265994 CACCCCAGGAAAGCCAGGAAGGG + Intronic
915541982 1:156573222-156573244 CAGCCAGGGAGAGGCCAGAAGGG + Intergenic
921079982 1:211731374-211731396 GAAGCCAGGAGAGGCCTGGATGG + Intergenic
922763049 1:228144321-228144343 CAACTCAGGCGAGGCGTGAATGG - Intronic
922899100 1:229122653-229122675 AACCTCAGGAGAAGCCAGAAAGG + Intergenic
923850840 1:237792603-237792625 CAGGCCAGGACAGCCCTGAAGGG - Intronic
1062855346 10:777361-777383 CACGCCGGGGGAGGCCTGTAGGG - Intergenic
1062855384 10:777458-777480 CACGCCAGGGGAGGCCTGTGGGG - Intergenic
1066480295 10:35789103-35789125 CACCCCAGCAGAGGCAGCAAAGG - Intergenic
1067693674 10:48520382-48520404 CAGCCCAGGAGGGGCCTAAGGGG + Intronic
1068878303 10:62021634-62021656 CACCCCAGAAAGGGCCAGAATGG - Intronic
1069718372 10:70534836-70534858 CAGCCCAGGTGAGGCATGGAAGG + Exonic
1070888942 10:79927908-79927930 CACCTCATGAGGGGCCTGTAAGG - Intergenic
1071553268 10:86583876-86583898 CACTCCAGAGGAGGCCTGAGGGG - Intergenic
1073224181 10:101902754-101902776 CTGCCCAGGAGAGGACTTAATGG + Intronic
1073593500 10:104778271-104778293 CACCCCTGGAGATGCATGTATGG - Intronic
1074954015 10:118369989-118370011 CACCCCAGGGCCTGCCTGAAGGG + Intergenic
1075038751 10:119090947-119090969 GACTCCAGGAGAAGGCTGAAGGG + Intergenic
1076201395 10:128561441-128561463 CACTCAAGGAGAAACCTGAATGG - Intergenic
1076629464 10:131843502-131843524 CACACCAGGAATGGGCTGAAGGG - Intergenic
1077407500 11:2389169-2389191 AACCCCAGGAGAGGTCTGAAGGG + Intronic
1077670301 11:4151312-4151334 GACCCCAGGAGAGGGCTGGGTGG + Intergenic
1078667902 11:13341273-13341295 GACCCCAGGACAGGCAGGAAGGG - Intronic
1079677143 11:23243423-23243445 TATACCAGGAGAGGCCTGAGTGG + Intergenic
1080636159 11:34125492-34125514 AGCCCAAAGAGAGGCCTGAAAGG - Intronic
1081695400 11:45105870-45105892 CACCCCTGGAGAGGCCTCTGTGG - Intronic
1081919694 11:46762113-46762135 AACCCCAGGAAAAGCCTTAAAGG - Exonic
1083695882 11:64442147-64442169 CACCTCAGAACTGGCCTGAAAGG + Intergenic
1083828727 11:65217696-65217718 CAGCCGAGGAGAGGCCAGGAAGG + Intergenic
1083902533 11:65650561-65650583 CACCCCAGGAGAAGGCGGACAGG + Exonic
1084672529 11:70615759-70615781 AACCCCAGGATTGGACTGAATGG - Intronic
1088914938 11:114220310-114220332 CACCACAGTGGAGGCCTGAATGG - Intronic
1089614538 11:119687801-119687823 CATCCCAGGAGGGGCCTGTGGGG + Intronic
1089625268 11:119747134-119747156 CACCCCTGGAGCCTCCTGAAAGG - Intergenic
1091086614 11:132727431-132727453 CTCCCCAGGAGAGCCCTGGCTGG - Intronic
1091695938 12:2628064-2628086 CACCCCAGGCAAGGAGTGAAAGG + Intronic
1092523904 12:9298021-9298043 GACCCCAGGAGAGGACTCCAGGG - Intergenic
1092543393 12:9433878-9433900 GACCCCAGGAGAGGACTCCAAGG + Intergenic
1093842703 12:23923819-23923841 CACCCCAGAATAGGGTTGAAAGG - Intronic
1094415770 12:30213322-30213344 CTTCCCAGGAGAGGCCTCAGGGG - Intergenic
1094509555 12:31088177-31088199 GACCCCAGGAGAGGACTCCAGGG - Intronic
1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG + Intronic
1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG + Intronic
1095303582 12:40614735-40614757 CACCCACGGAGAGGAATGAAAGG - Intergenic
1096261740 12:50096978-50097000 GAACCTAGGAGAGGTCTGAAGGG + Intronic
1096540578 12:52304779-52304801 CACCCCGGGAAGGGCCAGAAGGG + Intronic
1096979739 12:55721549-55721571 CACCCCAGGAGTCACCTGCAAGG + Intronic
1104966353 12:132510258-132510280 AGCCCCAGGAGAGGCCGGCAGGG - Intronic
1104986882 12:132602457-132602479 TCCCCCAGGAGAGACCTGCAGGG - Intergenic
1105337373 13:19486583-19486605 CACTCCAGGAGTGGCCTGAAGGG + Intronic
1106049931 13:26180446-26180468 CAGCCCAGGAGACCCCTCAAAGG + Intronic
1108409050 13:50129667-50129689 GACCCCAGGCGAGGCCAGGAAGG - Intronic
1108632645 13:52301986-52302008 CACTCCAGGAGTGGCCTGAAGGG + Intergenic
1108654054 13:52510607-52510629 CACTCCAGGAGTGGCCTGAAGGG - Intergenic
1112209645 13:97362980-97363002 CACCTCAGAAGATGCCTGATGGG - Intronic
1113492486 13:110703371-110703393 CAGCCCAGCAAAGGCCTGGAGGG + Intronic
1113531873 13:111033056-111033078 GACCCCAGCAGAGGCCAGGAAGG + Intergenic
1113946240 13:114045328-114045350 CTCACCACGAGAGGCCGGAAGGG + Intronic
1116131019 14:40855819-40855841 CACCTCAGGAGAGTCTTCAAGGG + Intergenic
1118824090 14:69364781-69364803 CACCCCAGGAGTGGGCAGGAGGG + Intergenic
1122996622 14:105268694-105268716 CACCCCAGGAGAGGCCCCCCAGG - Intronic
1124640308 15:31392609-31392631 ACCCCCAGGACAGGCCTGAGGGG - Intronic
1124880766 15:33640440-33640462 CACCCCAGGAATGGTCTGAGCGG + Intronic
1126299144 15:47175523-47175545 CACCACTAGAGAAGCCTGAAGGG - Intergenic
1128300701 15:66564825-66564847 CGCCCCAGGAGAAGCCTGCAGGG + Exonic
1129178226 15:73855273-73855295 CTCTCCAGGAGAGCCCTGAAGGG + Intergenic
1130876778 15:88021360-88021382 AACCCCAGAACAGCCCTGAATGG + Intronic
1131518103 15:93092791-93092813 CACTCTAGGAGAGCCCTGATTGG + Intergenic
1131871021 15:96764768-96764790 GACACCTGGAGAGGGCTGAAAGG + Intergenic
1132578819 16:675975-675997 GACCCCAGGAGAGGACTGACTGG + Intronic
1132687592 16:1168783-1168805 GGCTCCAGGAGAGGCCTGGAGGG - Intronic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1135551340 16:23400530-23400552 GGCCCCAGGAAAGGCCTCAAAGG + Intronic
1136227282 16:28867389-28867411 CAGCCCTGGAGATGCCTGACCGG + Exonic
1136538578 16:30914959-30914981 AAGCCCAGGAGAGGCCTCATAGG - Intergenic
1137669262 16:50269848-50269870 CACCCCATGAAAGGCTAGAATGG - Intronic
1137706578 16:50539705-50539727 CACCCCTGGCGAGGCCAGGAAGG - Intergenic
1138535431 16:57657484-57657506 TGCTCCAGGTGAGGCCTGAAAGG + Exonic
1139391869 16:66610362-66610384 CTTCCCAGGACAGGCCTGGATGG - Intronic
1141702534 16:85649060-85649082 CAACCCAGGAGAGGCCTCTGGGG - Intronic
1143130676 17:4675078-4675100 CAGGCCAGGAGAGGCCTTACAGG - Exonic
1146719957 17:35117157-35117179 CACCCAACTAGAGGCCTTAAGGG + Intronic
1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG + Intronic
1149212794 17:54322906-54322928 CACTCCATGAGAGTCCTGAAAGG + Intergenic
1150142088 17:62738814-62738836 AAACCCAGGAGGGGCCTGAGAGG - Intronic
1151227299 17:72656621-72656643 CTCCCCGGGAGAGGCCTGTCAGG - Intronic
1152375903 17:79918956-79918978 CCCCCCAGGCCAGGCCTGCAGGG + Intergenic
1152659294 17:81535007-81535029 CTACCCAGGAGAGGCGTGAGGGG + Intronic
1155098979 18:22589964-22589986 CCCACCAGGAGAGGGCTGCAGGG - Intergenic
1157218033 18:45801876-45801898 CCTCTCAGGAGAGCCCTGAAGGG - Intergenic
1157422063 18:47555719-47555741 CAAGCCAGGAGAGGCAGGAAGGG + Intergenic
1158489280 18:57895324-57895346 CACCCACGGAGAAGCCTGAGGGG + Intergenic
1159607239 18:70487660-70487682 CACCCCAGCAGTGGCCTCACGGG + Intergenic
1159910510 18:74141292-74141314 CACACCCGGAGAGCCATGAATGG + Intronic
1160849016 19:1180747-1180769 CACACCAGGAAGGGCCTGATTGG - Intronic
1160990339 19:1857785-1857807 CATCCCAGGAGAGCCAGGAAAGG + Intronic
1160993474 19:1871295-1871317 CACCTCCGGACAGGCCTGCAGGG + Intergenic
1161031123 19:2058187-2058209 CACCCCAGGGCCGGCCTGCAGGG - Intergenic
1161333195 19:3697907-3697929 CTCCCGAGGCGTGGCCTGAATGG - Intronic
1161399243 19:4060144-4060166 CAGCCCAGGAGGGGCCTGCCAGG - Intronic
1162389124 19:10378499-10378521 CACCCCAGCTAAGGCCTGAGGGG + Intronic
1163157042 19:15445303-15445325 TACCCCAGGGGTGCCCTGAAGGG + Intronic
1163548759 19:17953455-17953477 GACCCCAGAACAGGACTGAAGGG - Intronic
1164268117 19:23640826-23640848 CACCACAAGAAAGGCCAGAAAGG + Intronic
1164672053 19:30077831-30077853 CCACTCAGGAGAGGCATGAAGGG + Intergenic
1165747830 19:38240801-38240823 CACCCCAGTGGACGCCTGGAGGG + Intergenic
1167011725 19:46813190-46813212 CCTCCCAGGAGGGGCCTGGAGGG + Intergenic
926370926 2:12177974-12177996 CAGCCCAGGGGAGGCCCAAATGG + Intergenic
927240829 2:20918435-20918457 CAGCCCAGCAGGGGCCTCAACGG + Intergenic
931728360 2:65131610-65131632 CACCCCAGGAATACCCTGAATGG + Intergenic
932949857 2:76280338-76280360 CTCCCCAGTGGAGGCCTGATGGG - Intergenic
933688113 2:85159221-85159243 AACCCTAGGAAAGGCCTAAAAGG - Intronic
936092211 2:109508782-109508804 CACCCCAGATAAGGCATGAAAGG + Intergenic
937126043 2:119475571-119475593 CACCTCAGGGGACCCCTGAAAGG + Intronic
937634319 2:124138973-124138995 CACCCTAGTAGAGTACTGAAGGG - Intronic
942087827 2:172459779-172459801 TACCCCAGGATAGCCATGAAGGG + Intronic
942244225 2:173992238-173992260 CAGACCAGGACACGCCTGAAAGG + Intergenic
942795530 2:179814304-179814326 CCTCCCAGGAGAGGACTGCATGG + Intronic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
948059805 2:235034374-235034396 CAGCCCAGCAGAGGCCCCAAGGG - Intronic
948062817 2:235053974-235053996 CATCGAGGGAGAGGCCTGAAGGG + Exonic
948661426 2:239508923-239508945 CAGCCCAGGAGAGGCCAGGGAGG - Intergenic
948981363 2:241496564-241496586 GACCCCAGGACAGGCCTTCAGGG + Intronic
1170781274 20:19427684-19427706 CAGCCCAGGACAGGCCTGGGAGG - Intronic
1173253004 20:41374538-41374560 AGCCCCAGGAGGGGCCAGAAAGG + Intergenic
1173852693 20:46228752-46228774 CAGCCCAGGAGGGGCCTGCCTGG - Intronic
1174056001 20:47798961-47798983 CAACCCAGAAGAAGCCTGCATGG - Intergenic
1175966348 20:62661883-62661905 ATCCCCAGGAGAGGCCGGGAGGG - Intronic
1176672620 21:9748667-9748689 TACCCCGAGAGAGCCCTGAAGGG - Intergenic
1176736195 21:10548792-10548814 CACTCCAGGAGTGGCCTGAAGGG - Intronic
1179059348 21:37965317-37965339 CTTCCCTGGAGAGGCCTGCAAGG + Intronic
1180186930 21:46144759-46144781 CAGCCCAGGAGAGGACAGGAGGG - Intronic
1180350191 22:11794453-11794475 CACCCCAGGGGAGTCCTGGTTGG + Intergenic
1180855160 22:19040907-19040929 AGCCCCAGGAGAAGCCTTAAAGG + Intronic
1180984564 22:19896874-19896896 CACCCCTCCAGAGGCCTGGAGGG + Intronic
1181487833 22:23242670-23242692 GCCCCCAGGAGAGGGCTGGAAGG - Intronic
1183154569 22:36065420-36065442 AACCCACGGAGAGGCCTGTAGGG + Intergenic
1183532950 22:38374062-38374084 CACTCCAGGAGTGGCCTGAAGGG + Intronic
1183667978 22:39256180-39256202 CACCCCAACAGAAGCCTGGATGG - Intergenic
1184506901 22:44909326-44909348 AACCCCAAGAGAGGACAGAAGGG + Intronic
1185138015 22:49084341-49084363 AGCCCCAGGACAGGCCTGGAGGG - Intergenic
949357591 3:3198216-3198238 TACCCCAGAAGAGGCGGGAAGGG - Intergenic
949504546 3:4714609-4714631 CACCTCAGGAGAGGCTGGAGAGG - Intronic
951156709 3:19363382-19363404 CAGCTCTGAAGAGGCCTGAAAGG + Intronic
951925097 3:27900807-27900829 GACCCCAGGACAGGACTCAAAGG - Intergenic
953044307 3:39281332-39281354 GACCCCAGGAGAGGTATCAAGGG - Intronic
955742149 3:62102706-62102728 GACCCCTGGAGAGGTCTGAGAGG + Intronic
958925764 3:100155582-100155604 CAGCCCAGGAGGGTGCTGAAGGG - Intronic
961482987 3:127196047-127196069 CACTCCAGGAGAAACCTGACAGG + Intronic
961631994 3:128307900-128307922 AAGCCCAGGAGAGGCCTACAGGG - Intronic
961659062 3:128458752-128458774 GACTCCAGGAAAGGCCAGAATGG + Intergenic
961714564 3:128849680-128849702 GACCCCAGAAGAGTCATGAAAGG - Intergenic
962357622 3:134708454-134708476 CAAGCCTGGAGAGGCCTGACAGG - Intronic
963843397 3:150130781-150130803 CTTCCCAGGAGAAGCCTGGAGGG + Intergenic
965602526 3:170469172-170469194 CAGCCCAGCAGAAGCCTGCAGGG - Intronic
966573918 3:181477852-181477874 CACCCATGGAGAGGAATGAAAGG - Intergenic
967327357 3:188254726-188254748 CACCCGAGGAGAGGCATTGAAGG - Intronic
968135015 3:196214907-196214929 GACCCCAGGAGAGACCGGCAGGG - Intronic
968635542 4:1676625-1676647 TACCCAAGGACAGGGCTGAAGGG - Intronic
969705233 4:8788177-8788199 CTCCCCAGGAGAGGGCTGCTGGG + Intergenic
970051724 4:11922094-11922116 CAACACAGGACAGCCCTGAAGGG + Intergenic
970194709 4:13542715-13542737 CTCCCCAGAAGAGGCCTAGATGG - Intronic
974507252 4:62791587-62791609 CACCCCAGATGAGGACTGACTGG + Intergenic
981568866 4:146131046-146131068 CAGTCCAGCAGAGGCCTAAAGGG + Intergenic
985402103 4:189603164-189603186 TACCCCGAGAGAGCCCTGAAGGG + Intergenic
985655698 5:1130460-1130482 CACCCCAGGAGAGGCCACCTGGG + Intergenic
985724081 5:1506538-1506560 CCCCCCAGGAGATGCCAGTATGG + Intronic
990012438 5:51016004-51016026 CACCCCAGGAGAGCTTTGGATGG + Intergenic
997243769 5:132328628-132328650 CACCCCAGCACAGCCCTGAAGGG - Intronic
1001315969 5:170641557-170641579 CACCCCAGCAGAGGGTTGAGAGG - Intronic
1001432335 5:171672758-171672780 CAACACAGGAGAGGCCAGGAAGG - Intergenic
1001595880 5:172898478-172898500 CATGCCAGGGGAGGGCTGAAAGG - Intronic
1001741113 5:174053424-174053446 CTCTGCAGGGGAGGCCTGAAAGG + Intronic
1001781437 5:174372183-174372205 CAGCCCAGCAGAGGATTGAAGGG + Intergenic
1002365858 5:178710309-178710331 CAGTCCAGGAGAGCCCTGTATGG - Intergenic
1003436177 6:6090689-6090711 CACTCCAGGAGAGCCCTAACTGG + Intergenic
1004325004 6:14666421-14666443 CGCTCTAGGAGAGCCCTGAATGG - Intergenic
1005733248 6:28719458-28719480 TTCCCAAGAAGAGGCCTGAAGGG - Intergenic
1006096276 6:31658707-31658729 CACCCCAGGAGAGTTTTCAAAGG + Exonic
1006439069 6:34042112-34042134 AACATCAGGAGAGGCCTGATGGG + Intronic
1006562583 6:34926373-34926395 CACCCCATCACAGGCATGAATGG - Intronic
1006899039 6:37488292-37488314 CACAGCAGGATGGGCCTGAAAGG + Intronic
1007745973 6:44043107-44043129 CACCCCCAGGGAGGCCTGAAGGG - Intergenic
1009719972 6:67456196-67456218 CATCACTGGGGAGGCCTGAATGG - Intergenic
1009849625 6:69179682-69179704 CACCCCAGGGAAGGAATGAAAGG - Intronic
1009863854 6:69371081-69371103 CAATCAAGGAGAGGGCTGAAAGG - Intronic
1014260084 6:119206360-119206382 GACGCCAGGACAGGACTGAAAGG - Intronic
1019316931 7:391184-391206 CAGCCCAGGGGAGTCGTGAAAGG + Intergenic
1019937259 7:4264764-4264786 CACCCCAGGAGAGGTCTACACGG - Intronic
1023455457 7:40333909-40333931 CACCCCACGACAGGCCTCAGTGG + Intronic
1024246825 7:47477126-47477148 CATCCCAGGACAGGACTGTAAGG - Intronic
1025236991 7:57241193-57241215 CAACCCAGGAGAAGCCTGTATGG + Intergenic
1026566400 7:71493184-71493206 AAACCCAGGAGAGCCTTGAAAGG - Intronic
1027221891 7:76219482-76219504 CAGCCCAGCAGAAGCCTGAGGGG + Intronic
1027968625 7:85046778-85046800 AAGCCCAGAAGAGGGCTGAAAGG + Intronic
1028920701 7:96307048-96307070 CACCCCAGGAGTGGCCCATAGGG - Intronic
1030200286 7:106896166-106896188 TACCCAAGGAGAGGCGTTAAAGG - Intronic
1031141296 7:117946443-117946465 CTCCCAAGGTGAGGCCTGAATGG - Intergenic
1031268361 7:119611644-119611666 CACTCTAGGAGAGGCCTGACAGG - Intergenic
1032755072 7:134882236-134882258 AACCCCAGGAGAGGCATTGATGG - Intronic
1033909890 7:146249631-146249653 CATGCCATGAGAGGACTGAATGG - Intronic
1034497420 7:151431137-151431159 CCCTCCAGCAGAGTCCTGAATGG - Intronic
1034530008 7:151689712-151689734 AACCCCAGGAGAGCCCTGGTTGG - Intronic
1035486799 7:159232488-159232510 CACCCAGGGAGAGGCTTGACGGG + Intergenic
1037173431 8:15920308-15920330 CAACCCAAGTCAGGCCTGAAAGG + Intergenic
1038004237 8:23416474-23416496 CACCACAGGGGAGGCGGGAAAGG + Intronic
1038407963 8:27335962-27335984 CACCCCAGGAGATCCATGGAGGG - Intronic
1039243523 8:35582734-35582756 CACTCCTGGAGAGGGATGAAAGG - Intronic
1040046247 8:42966984-42967006 CACCTCATGAGAGAACTGAAGGG - Intronic
1045235533 8:100349918-100349940 TACCCCTGGAGAGGCCTAGATGG + Intronic
1045595643 8:103651343-103651365 CACTCAAGGAGAGGAATGAAAGG - Intronic
1047186139 8:122635045-122635067 CACCCCAGGAGAACCCTGCCTGG + Intergenic
1047927146 8:129693092-129693114 CACCCCAGGAATGGCTAGAAAGG + Intergenic
1048290855 8:133180747-133180769 GACCCCAGCAGAGGCCTTCATGG - Intergenic
1048333738 8:133488615-133488637 CTCCCCTGGAGAGCCCTGACTGG + Intronic
1048840848 8:138564614-138564636 AACCCCAGTAGAGCCCTGCATGG + Intergenic
1048893320 8:138966788-138966810 CATCCCAGGTGAGGCATGAGTGG - Intergenic
1049213511 8:141397389-141397411 CAACCCAGGACAGGCCTTACAGG - Intronic
1049583885 8:143424223-143424245 CAGCCCTGGAGGGCCCTGAAGGG - Intronic
1049623874 8:143611525-143611547 CACCTCAGCTGAGGCCTAAAAGG + Intergenic
1050277472 9:4014799-4014821 CACACCTGGAGAGACTTGAATGG + Intronic
1051800365 9:20926005-20926027 CAACGCAGGAGAGCTCTGAAGGG + Intronic
1054928465 9:70611785-70611807 CTCTCCAGGTCAGGCCTGAATGG - Intronic
1055411086 9:76030248-76030270 CTCTCCATGAGAGTCCTGAAAGG + Intronic
1055726070 9:79230368-79230390 AACTCCAGAAGAGGACTGAAAGG + Intergenic
1057741366 9:97714774-97714796 CACACCACCAGAAGCCTGAAGGG - Intergenic
1057888934 9:98853298-98853320 CTCTCCAGGAGAGCCCTGACGGG + Intergenic
1058161815 9:101578492-101578514 CACCACAGGAGAGGCCAGGATGG + Intronic
1059025734 9:110626743-110626765 CTCCCTAGGAGAGCCCTGATAGG - Intergenic
1060789197 9:126474358-126474380 CTCCCCAGGAGAAGCCAGGACGG + Intronic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1061090668 9:128424265-128424287 CCCCCCAGGTGAGGCCGGGATGG + Exonic
1061099166 9:128479036-128479058 TGCCCCAGGGGAGGCCTGGAGGG + Intronic
1061281737 9:129601527-129601549 AACCCCAGGAGAGTCCTGACTGG + Intergenic
1061571316 9:131479058-131479080 CCCCCCAAGAAAGACCTGAAAGG - Intronic
1061877315 9:133550851-133550873 CACCCCAGTAGAAGACAGAATGG - Intronic
1062106142 9:134756077-134756099 CACCACAGGAGAGCCCTGCAAGG - Intronic
1062209761 9:135357151-135357173 CATCACAGCAGAGCCCTGAAGGG + Intergenic
1062219827 9:135409216-135409238 CACCCCAGGAGAAGGGGGAAGGG + Intergenic
1062265213 9:135683760-135683782 CACCCCAGGCCAGCCCTGAGGGG + Intergenic
1186447947 X:9647873-9647895 TTCCCCAAGAGAGACCTGAAAGG - Intronic
1187896013 X:23980283-23980305 CACCCAAGAAGAGACCTAAAAGG - Intergenic
1189187967 X:39070287-39070309 CAGCCCAGGGGCGGGCTGAAGGG + Intergenic
1191889662 X:65926980-65927002 CACTCAAGGAGAGGAATGAAAGG - Intergenic
1192432952 X:71125058-71125080 CACCCAAGGAGAAGATTGAAGGG + Exonic
1198399629 X:136256477-136256499 CACCCCAGGGAAGACCTAAAAGG - Intronic
1200239741 X:154487162-154487184 CACCCCCGGGGAGGGCTGATAGG + Intergenic
1200750191 Y:6937859-6937881 CAGCACAGGAGAGACCTGCAGGG - Intronic
1202177572 Y:22111936-22111958 GACCACAGAAGATGCCTGAAGGG - Intergenic
1202213789 Y:22474448-22474470 GACCACAGAAGATGCCTGAAGGG + Intergenic
1202594490 Y:26521956-26521978 CACTCCAGGAGTGGCCTGAAGGG - Intergenic