ID: 1095118915

View in Genome Browser
Species Human (GRCh38)
Location 12:38390272-38390294
Sequence TGAGCTTTTAAAATATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095118915_1095118916 12 Left 1095118915 12:38390272-38390294 CCATCATATATTTTAAAAGCTCA No data
Right 1095118916 12:38390307-38390329 AGAAAAAAACGATAGAAAAATGG No data
1095118915_1095118917 30 Left 1095118915 12:38390272-38390294 CCATCATATATTTTAAAAGCTCA No data
Right 1095118917 12:38390325-38390347 AATGGACAAGAGTTATGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095118915 Original CRISPR TGAGCTTTTAAAATATATGA TGG (reversed) Intergenic
No off target data available for this crispr