ID: 1095121508

View in Genome Browser
Species Human (GRCh38)
Location 12:38424871-38424893
Sequence AGTTTTCTGCAGAAAATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095121504_1095121508 16 Left 1095121504 12:38424832-38424854 CCCTGTCACAGGCCAAGAGTTGC No data
Right 1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG No data
1095121505_1095121508 15 Left 1095121505 12:38424833-38424855 CCTGTCACAGGCCAAGAGTTGCC No data
Right 1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG No data
1095121502_1095121508 25 Left 1095121502 12:38424823-38424845 CCACCAAAGCCCTGTCACAGGCC No data
Right 1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG No data
1095121507_1095121508 -6 Left 1095121507 12:38424854-38424876 CCTCTCAAAAAGAGAGTAGTTTT No data
Right 1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG No data
1095121503_1095121508 22 Left 1095121503 12:38424826-38424848 CCAAAGCCCTGTCACAGGCCAAG No data
Right 1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG No data
1095121506_1095121508 4 Left 1095121506 12:38424844-38424866 CCAAGAGTTGCCTCTCAAAAAGA No data
Right 1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095121508 Original CRISPR AGTTTTCTGCAGAAAATGCC AGG Intergenic
No off target data available for this crispr