ID: 1095131378

View in Genome Browser
Species Human (GRCh38)
Location 12:38547497-38547519
Sequence TTATCCATGAACTTTTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095131376_1095131378 7 Left 1095131376 12:38547467-38547489 CCTCAGGCCACAATGCACACTCT No data
Right 1095131378 12:38547497-38547519 TTATCCATGAACTTTTAAAGAGG No data
1095131370_1095131378 30 Left 1095131370 12:38547444-38547466 CCTGTCACCCCTTTACCTCTTTA No data
Right 1095131378 12:38547497-38547519 TTATCCATGAACTTTTAAAGAGG No data
1095131375_1095131378 15 Left 1095131375 12:38547459-38547481 CCTCTTTACCTCAGGCCACAATG No data
Right 1095131378 12:38547497-38547519 TTATCCATGAACTTTTAAAGAGG No data
1095131374_1095131378 21 Left 1095131374 12:38547453-38547475 CCTTTACCTCTTTACCTCAGGCC No data
Right 1095131378 12:38547497-38547519 TTATCCATGAACTTTTAAAGAGG No data
1095131373_1095131378 22 Left 1095131373 12:38547452-38547474 CCCTTTACCTCTTTACCTCAGGC No data
Right 1095131378 12:38547497-38547519 TTATCCATGAACTTTTAAAGAGG No data
1095131377_1095131378 0 Left 1095131377 12:38547474-38547496 CCACAATGCACACTCTCTTTAGT No data
Right 1095131378 12:38547497-38547519 TTATCCATGAACTTTTAAAGAGG No data
1095131371_1095131378 23 Left 1095131371 12:38547451-38547473 CCCCTTTACCTCTTTACCTCAGG No data
Right 1095131378 12:38547497-38547519 TTATCCATGAACTTTTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095131378 Original CRISPR TTATCCATGAACTTTTAAAG AGG Intergenic
No off target data available for this crispr