ID: 1095132316

View in Genome Browser
Species Human (GRCh38)
Location 12:38558839-38558861
Sequence AAATGATGGTAGCAGTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095132316_1095132319 10 Left 1095132316 12:38558839-38558861 CCTACAAACTGCTACCATCATTT No data
Right 1095132319 12:38558872-38558894 TTGGAAAAATTGAAAACACAAGG No data
1095132316_1095132318 -9 Left 1095132316 12:38558839-38558861 CCTACAAACTGCTACCATCATTT No data
Right 1095132318 12:38558853-38558875 CCATCATTTAGAAAAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095132316 Original CRISPR AAATGATGGTAGCAGTTTGT AGG (reversed) Intergenic
No off target data available for this crispr