ID: 1095133580

View in Genome Browser
Species Human (GRCh38)
Location 12:38571632-38571654
Sequence AGCCCAGGCTGCTCAGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095133572_1095133580 8 Left 1095133572 12:38571601-38571623 CCAAGAGAGTGCTGGCATCGCCC No data
Right 1095133580 12:38571632-38571654 AGCCCAGGCTGCTCAGCTCATGG No data
1095133570_1095133580 21 Left 1095133570 12:38571588-38571610 CCAGCTGTGGCAGCCAAGAGAGT No data
Right 1095133580 12:38571632-38571654 AGCCCAGGCTGCTCAGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095133580 Original CRISPR AGCCCAGGCTGCTCAGCTCA TGG Intergenic
No off target data available for this crispr