ID: 1095135253

View in Genome Browser
Species Human (GRCh38)
Location 12:38593152-38593174
Sequence TGATACTGGTTGGATAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095135248_1095135253 15 Left 1095135248 12:38593114-38593136 CCTACAAGGGCTGAGAGCTCAAG No data
Right 1095135253 12:38593152-38593174 TGATACTGGTTGGATAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095135253 Original CRISPR TGATACTGGTTGGATAAAAT TGG Intergenic
No off target data available for this crispr