ID: 1095135470

View in Genome Browser
Species Human (GRCh38)
Location 12:38596006-38596028
Sequence CTGTATTTCAATCAGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095135469_1095135470 12 Left 1095135469 12:38595971-38595993 CCATGTTTCAACACGGTTACTCA No data
Right 1095135470 12:38596006-38596028 CTGTATTTCAATCAGCAGAAAGG No data
1095135468_1095135470 13 Left 1095135468 12:38595970-38595992 CCCATGTTTCAACACGGTTACTC No data
Right 1095135470 12:38596006-38596028 CTGTATTTCAATCAGCAGAAAGG No data
1095135466_1095135470 18 Left 1095135466 12:38595965-38595987 CCCATCCCATGTTTCAACACGGT No data
Right 1095135470 12:38596006-38596028 CTGTATTTCAATCAGCAGAAAGG No data
1095135467_1095135470 17 Left 1095135467 12:38595966-38595988 CCATCCCATGTTTCAACACGGTT No data
Right 1095135470 12:38596006-38596028 CTGTATTTCAATCAGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095135470 Original CRISPR CTGTATTTCAATCAGCAGAA AGG Intergenic
No off target data available for this crispr