ID: 1095145568

View in Genome Browser
Species Human (GRCh38)
Location 12:38721983-38722005
Sequence CCTTGGCAGGCGTGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 907
Summary {0: 1, 1: 10, 2: 177, 3: 296, 4: 423}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095145558_1095145568 3 Left 1095145558 12:38721957-38721979 CCCTCACCACTTCATACCTGATT 0: 1
1: 0
2: 3
3: 39
4: 247
Right 1095145568 12:38721983-38722005 CCTTGGCAGGCGTGGGATGCAGG 0: 1
1: 10
2: 177
3: 296
4: 423
1095145560_1095145568 -3 Left 1095145560 12:38721963-38721985 CCACTTCATACCTGATTCACCCT 0: 1
1: 0
2: 0
3: 20
4: 211
Right 1095145568 12:38721983-38722005 CCTTGGCAGGCGTGGGATGCAGG 0: 1
1: 10
2: 177
3: 296
4: 423
1095145559_1095145568 2 Left 1095145559 12:38721958-38721980 CCTCACCACTTCATACCTGATTC 0: 1
1: 0
2: 1
3: 28
4: 215
Right 1095145568 12:38721983-38722005 CCTTGGCAGGCGTGGGATGCAGG 0: 1
1: 10
2: 177
3: 296
4: 423
1095145557_1095145568 4 Left 1095145557 12:38721956-38721978 CCCCTCACCACTTCATACCTGAT 0: 1
1: 0
2: 3
3: 39
4: 233
Right 1095145568 12:38721983-38722005 CCTTGGCAGGCGTGGGATGCAGG 0: 1
1: 10
2: 177
3: 296
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095145568 Original CRISPR CCTTGGCAGGCGTGGGATGC AGG Intronic
900145942 1:1158680-1158702 CCTTGGTAGGTGGGGGATGCCGG + Intergenic
900686065 1:3948399-3948421 CCTTGGCAGGGGTGGGAAAGTGG + Intergenic
901499141 1:9640867-9640889 CCTGGGCAGTGGTGGCATGCTGG - Intergenic
902644633 1:17789960-17789982 CCTTGGCAGGCGTGGGACCCAGG - Intronic
903181457 1:21607023-21607045 CCTGGGCAGGCCTGGGCAGCCGG + Intronic
903269354 1:22178019-22178041 CCTGGGCAGGCAGGGGGTGCGGG - Intergenic
904302339 1:29562399-29562421 CCTTAGCAGGTCTGGGCTGCAGG - Intergenic
904370222 1:30043509-30043531 CCTTGGCAGGCATGGGATCCAGG + Intergenic
904403818 1:30273606-30273628 CCTTGGCAGGTTTGGGATCCAGG - Intergenic
904461169 1:30680675-30680697 CCTTGGCAGGCATGGGATCCAGG + Intergenic
904551906 1:31325645-31325667 CCTTGGCAGGTGTGGGATCTGGG + Intronic
904732570 1:32606098-32606120 CCTCGGCAGGCATGAGATCCAGG - Intronic
905034220 1:34906799-34906821 CCTTGGCAAGTCTGGGATGGGGG - Intronic
905040232 1:34950093-34950115 CCTTGGTATCCGTGGGAGGCTGG - Intergenic
905546244 1:38802409-38802431 CCTTGGCAAGTGTGGGATCCAGG + Intergenic
906051677 1:42879952-42879974 CCTTGGCAGGCATGGGATCCGGG - Intergenic
906132310 1:43468038-43468060 CCTTGGCAGGCATGGCATCCAGG - Intergenic
906913652 1:49983480-49983502 CTTTGGCAGGCATGGGATCCAGG + Intronic
907153096 1:52306933-52306955 CCTTGACAGACATGGGATCCAGG + Intronic
907614936 1:55913745-55913767 CCTTGGCAGGCATGGGATCCAGG + Intergenic
907985474 1:59525272-59525294 CCTTGGTAGGTGTGGGATCCAGG + Intronic
908939028 1:69409987-69410009 CCCTGGCAGGCATGGGATCCAGG + Intergenic
909907952 1:81221828-81221850 CCTTCACAGACGTGGGATCCAGG + Intergenic
910101327 1:83581956-83581978 CCTTGGCAGGCATGGGATCCAGG - Intergenic
910260014 1:85285179-85285201 CCTTGGCAGGCATGAGATTCAGG + Intergenic
910601991 1:89042617-89042639 TCTTGGCAGGCACGGGATCCAGG - Intergenic
911004011 1:93199217-93199239 CCTTGGCAGGTGTGGGATCCAGG - Intronic
911025176 1:93427901-93427923 CCTTGGCAGCCGTAGGATCCAGG + Intergenic
911475298 1:98366454-98366476 TCTTGGCAGGTGTGGGATCCAGG - Intergenic
911497534 1:98650050-98650072 CCTTGACAGGCATGGGATTCGGG - Intergenic
912094593 1:106122000-106122022 CCTTGGCAGGTATCGGATCCAGG + Intergenic
912132668 1:106620796-106620818 CGTTGGCAGGCATGGGATCCAGG + Intergenic
912210976 1:107556641-107556663 CCTTGGCAGGGATGGGAGGATGG + Intergenic
912881620 1:113422457-113422479 CCTTGGCAGGTATGGGATCCGGG - Intronic
912943081 1:114061872-114061894 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
914047859 1:144105512-144105534 TCTTGGCTGGCTTGGGTTGCTGG + Intergenic
914392598 1:147235978-147236000 CCTTGGCTGGCATGGGATCCAGG - Intronic
915184973 1:154097993-154098015 CCTTGGCAGGTGTGAGATCCAGG - Intronic
915828657 1:159105071-159105093 CCTTGGCAGGCATGGGATCTGGG - Intronic
916965993 1:169944139-169944161 CCTTGGCAGGTGTGGGATCCAGG - Intronic
918963104 1:191305993-191306015 CCTCAGCAGGTGTGGGATCCCGG - Intergenic
918983548 1:191595287-191595309 CCTTGGCGGGCATGGGATCCAGG - Intergenic
919168629 1:193927086-193927108 CCTTGGTAGGCATGGGATCCAGG - Intergenic
919264135 1:195238581-195238603 CCTTGGCAGGTATGGGATTTGGG + Intergenic
919300848 1:195763521-195763543 CTTTGGCAGCCGTGGGATCCAGG + Intergenic
919454070 1:197801926-197801948 CTTTGGCAGGCATGGAATCCAGG + Intergenic
920078499 1:203354622-203354644 CCAAGGCAGGCCTGGGATGAAGG + Intergenic
921625517 1:217373986-217374008 CCTTGGCAGGCATGAGATTCAGG + Intergenic
921675369 1:217969647-217969669 CCTTGGCAGGTGTGGGTTCTGGG + Intergenic
921705858 1:218322864-218322886 TCTTGGCAGGCATGGGATCCAGG - Intronic
921766810 1:218982666-218982688 CCTTGGCAGCTGTGGGATCCCGG - Intergenic
922141547 1:222893443-222893465 CTTTGGCAGGTGTGGGATCCGGG - Intronic
923328295 1:232899527-232899549 CCTTGGCAGGCATGGCATCTGGG + Intergenic
923786045 1:237070629-237070651 CCTTGGCAGGTGTGGGATCTGGG - Intronic
923917827 1:238529389-238529411 CCTTGGCTGGTGTGGGATCCAGG - Intergenic
924386658 1:243505125-243505147 CCTTGGCTGGTCTGGGATGTCGG + Exonic
924404777 1:243730979-243731001 CCTCATCAGGCGTGGGATCCGGG + Intronic
924460339 1:244253342-244253364 GCTTGGTAGGCCTGGGATGGGGG + Intergenic
924944629 1:248838171-248838193 CCTTGGCCCGCGCGGGAGGCGGG + Intergenic
1062769922 10:91426-91448 CCTTGGCAGGCAGGAGATCCAGG - Intergenic
1062771303 10:103929-103951 CCCTGGCAGGCATGGGATCCAGG - Intergenic
1064010456 10:11731033-11731055 CCTTGGCAGGTGCAGGATCCAGG + Intergenic
1064229287 10:13515824-13515846 CCTTGGCAGGCCAGGGTTGTGGG - Intronic
1065201329 10:23316118-23316140 CCTTGGCAGGCATGGGATCCAGG - Intronic
1065408331 10:25392351-25392373 CCTTGGCAGGTGTGGGATCCAGG + Intronic
1065830492 10:29609843-29609865 CCTTGGCAGGCATGGGATCCAGG + Intronic
1065976671 10:30847885-30847907 CCTTGGCAGGCATGGGATCTAGG + Intronic
1066101412 10:32121782-32121804 CCTTGGCAGGCATGGGATCCAGG - Intergenic
1066189001 10:33037944-33037966 CCTTGGCAGGCGTGGGATCTGGG + Intergenic
1066508352 10:36067553-36067575 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1067018168 10:42772857-42772879 CCTTGGCAGGCCTGGGATCCAGG + Intergenic
1067226212 10:44377832-44377854 CCCTGGGAGGAGAGGGATGCAGG + Exonic
1068083727 10:52348485-52348507 CCTTGGCAGGAATGGGAACCAGG + Intergenic
1068130638 10:52890533-52890555 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
1068157550 10:53221915-53221937 CCTTGGTAGGCTTGGGATCCAGG - Intergenic
1068213335 10:53951799-53951821 CCTTGGCAGGCATGGGATCTGGG - Intronic
1068279763 10:54854000-54854022 CTTTGGCAGGCATGGGACCCAGG - Intronic
1068287868 10:54962775-54962797 CTTTAGCAGGCATGGGATCCGGG + Intronic
1068291065 10:55001692-55001714 CCTTGGAAGGTGTGGGATCCAGG + Intronic
1068444011 10:57096356-57096378 CCTTGGCAGGCTTGGTGTCCAGG + Intergenic
1068474562 10:57508029-57508051 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
1069004131 10:63298193-63298215 CCTTGATAGGCGTGAGATCCAGG + Intronic
1069160141 10:65083418-65083440 CCTTGGCAGGCATGGGATCTGGG - Intergenic
1069248981 10:66245075-66245097 CCTTGGCAGGCATGGGATCTAGG - Intronic
1069561632 10:69435083-69435105 CCTTGGTAGGCATGGGATCCAGG - Intergenic
1069575840 10:69528072-69528094 CCTTGGTAGGCATGGGATCCGGG - Intergenic
1069593101 10:69653908-69653930 CCCTGGGAGGTGTGGGATCCAGG + Intergenic
1069757381 10:70781661-70781683 CTTTGGCAGCCCTGGGATCCTGG + Intronic
1069807847 10:71137129-71137151 CTTTGGCAGGGAGGGGATGCTGG - Intergenic
1070096069 10:73339557-73339579 CCTTGGCAGGCGTGGGATCCAGG - Intronic
1070201054 10:74206976-74206998 CCTTGGCAGGTGTGGGATCCAGG - Intronic
1071166660 10:82815792-82815814 CCTTAGCAGGTGTGGGATCCAGG - Intronic
1072731640 10:97850382-97850404 GCTGGGCAGGAGTGGGAGGCGGG + Intronic
1073131413 10:101191355-101191377 CCTTGGAAGGCCTGGGCTCCAGG - Intergenic
1073733697 10:106321077-106321099 CCTTGGCAGGCATGGGATCCTGG + Intergenic
1073845214 10:107545984-107546006 CCTTGGTAGGCGTGGGATCCAGG + Intergenic
1073890493 10:108096097-108096119 CCTTGGCAGCTGTGGGATCTGGG - Intergenic
1073930361 10:108567414-108567436 CCCTTGGAGGCGTGGGATCCAGG + Intergenic
1074028912 10:109664750-109664772 CCTTGGCAGGCGTGGGACCCAGG + Intergenic
1074295470 10:112183660-112183682 CCAGGGCAGGTGTGGGCTGCGGG - Intronic
1074301671 10:112239486-112239508 CCTTGGCAGGTGTGGGATCTGGG - Intergenic
1074525503 10:114259985-114260007 CCTCGACAGGCGTGGGACGTGGG - Intronic
1074738787 10:116464488-116464510 CCTTGGCAGGTGTGAGATCCAGG - Intronic
1074991440 10:118712261-118712283 CCTTGGCAGCTGTGGGACCCAGG - Intronic
1075131950 10:119748065-119748087 CATTGGCAGGCATGGGATCCGGG - Intronic
1075412597 10:122240023-122240045 ACTTGGCAGCCTTGGGATCCTGG + Intronic
1075896831 10:126003487-126003509 CATTGGGAGGCCTGTGATGCAGG + Intronic
1076337321 10:129716473-129716495 GCTTGGCAGGCGGGGGATCGCGG - Intronic
1076413831 10:130270928-130270950 CCTCTCCAGGCGGGGGATGCGGG + Intergenic
1076915824 10:133422862-133422884 CCTGGGCAGGCGAGGGGAGCCGG + Exonic
1076935960 10:133567700-133567722 CCTGGGCAGGCATGGGGAGCTGG + Intronic
1077504707 11:2924603-2924625 CCTTGGCAGGCCTGGCAGGGCGG + Intronic
1077912840 11:6587777-6587799 TCTTGGCAGGCATGGGACCCAGG + Intronic
1077941587 11:6848855-6848877 CTTTTCCAGGTGTGGGATGCAGG - Intergenic
1078345408 11:10543935-10543957 CCTTGGCAGGCATGGGATCTGGG - Intergenic
1079119934 11:17674807-17674829 CCAAGGCAGGCATGGGATGCAGG - Intergenic
1079136773 11:17779853-17779875 CCCTGGCAGCTGTGGGTTGCTGG + Intronic
1079312417 11:19378434-19378456 CCTTGGCAGACGTGGGGAGGTGG + Intronic
1079674214 11:23203710-23203732 CTTTAGCAGGCATGGGATCCGGG + Intergenic
1080485867 11:32705565-32705587 TCTTGGCAGGCATGGGATCTGGG + Intronic
1080706816 11:34702544-34702566 CCTTGGCAGGCATGGTATCCAGG + Intergenic
1080851863 11:36077472-36077494 CCTTGGCAGGTATGGGATCTAGG - Intronic
1080966865 11:37223971-37223993 CCTTGGCAAGCATGGGATACAGG - Intergenic
1081010867 11:37811524-37811546 TCTTGGCAGGCATGGGATCCAGG - Intergenic
1081163799 11:39784984-39785006 CCTTGGCAGGTGTGAGATCCAGG - Intergenic
1081283874 11:41245311-41245333 CCTTGACAAGCATGGGATCCAGG - Intronic
1081767235 11:45620246-45620268 TCTTGGAAGGCATGGGATCCAGG - Intergenic
1082661809 11:55920773-55920795 CCATGGCAGGCATGGGATCTGGG + Intergenic
1082749980 11:57005191-57005213 CCTTGGCAGGAGTGGGATCCAGG - Intergenic
1083581646 11:63828802-63828824 CCATGGCAGGTGTGGTAAGCAGG + Intergenic
1084212879 11:67631942-67631964 CCAGGGCAGGCCTGGGATGAGGG - Intronic
1084971599 11:72775085-72775107 CCTTGGCCTGCTTAGGATGCAGG + Intronic
1085100745 11:73797715-73797737 CCTTGGCAGGCGTGGGACCCAGG + Intronic
1085273584 11:75284201-75284223 CCTTGACAGGCTGGGGATGGGGG + Intronic
1085315612 11:75543108-75543130 CCTTGCAGGGCGTGCGATGCGGG + Intergenic
1085334087 11:75678136-75678158 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
1085497023 11:76979019-76979041 CCTTGGCAGGCATGGGATCCAGG + Intronic
1085680920 11:78574482-78574504 CCTGGGCGGACGCGGGATGCTGG - Exonic
1086268114 11:85027520-85027542 CCTTGGCAGGTGTGAGATCGAGG - Intronic
1086508164 11:87527842-87527864 CCTTGGAAGGTGTGGGATCTGGG - Intergenic
1086850366 11:91800411-91800433 CCTTGGCAGGCATGGGATCTCGG + Intergenic
1086946931 11:92853089-92853111 CCTTGGCAGGTGTGGGATCTGGG - Intronic
1087131509 11:94672837-94672859 CCTTGGCAGGTGTGGGATCAGGG + Intergenic
1087175462 11:95091185-95091207 CCTGGGCAGGGGTGGGAGGCTGG - Intronic
1087210917 11:95446069-95446091 CCTTGGCAGGCATGGGGTCCAGG - Intergenic
1087266905 11:96070678-96070700 CCTTGGCAAGTGTGGGATCCAGG + Intronic
1087385288 11:97462180-97462202 CCTTGGCAGACATGGGATCCAGG + Intergenic
1087453294 11:98352590-98352612 CCTTGGCAGTCATGGGATCTGGG - Intergenic
1088513427 11:110600531-110600553 CTCTGGCAGGCATGGGATCCAGG + Intronic
1089470428 11:118716099-118716121 TCTTTGCAGGCGGGGGATGAGGG + Intergenic
1090116416 11:123978988-123979010 CCTTGGCAAGCATGGAATCCAGG - Intergenic
1090194483 11:124802901-124802923 CCTTGGCAGGTGTGGGATCTGGG - Intergenic
1090387184 11:126364104-126364126 CCTTGGCAGGGTTGGGACTCCGG - Intronic
1090910006 11:131110669-131110691 CTTTGGCAGTCATGGGATCCAGG - Intergenic
1091311504 11:134578200-134578222 GCTTGGCAGGCAGGGGATGGGGG + Intergenic
1091409512 12:229879-229901 CCTCGGCAGGGGTGGGAGGTCGG + Intronic
1092271899 12:7030383-7030405 CCTTGGCAGGTGTGGGATCCGGG - Intronic
1093492863 12:19725208-19725230 CCTTGGCAGGGATGGGATCCAGG - Intergenic
1093502315 12:19827294-19827316 CTTTGGCAGGCATGGGATCTGGG - Intergenic
1093525566 12:20101284-20101306 CCTTGGCAGGTGTGGAATTCAGG - Intergenic
1094675148 12:32612350-32612372 CTTTGGCAGGCCTGGGATCTGGG + Intronic
1095145568 12:38721983-38722005 CCTTGGCAGGCGTGGGATGCAGG + Intronic
1095749566 12:45696178-45696200 CCTTGGCAGGTGTGGGATTCTGG - Intergenic
1096294919 12:50375909-50375931 CCTTGGCAGGCATGGGATCCGGG - Intronic
1096295517 12:50380849-50380871 CCTTGGCAGGCATGGGATCCAGG - Intronic
1096693723 12:53335967-53335989 CCATGGAAGGGGTGGGAAGCAGG + Intronic
1097078452 12:56412331-56412353 CCATGGCAGGCATGGAATCCAGG - Intergenic
1097129815 12:56803849-56803871 CCTTGGCAGGCATGGGTCCCAGG - Intergenic
1097130728 12:56809190-56809212 CCTTAGCAGGCATGGGAACCAGG - Intergenic
1097140758 12:56900824-56900846 CCCTTGAAGGCGTGGGATCCAGG + Intergenic
1097298834 12:57997205-57997227 CCTTGGCAGGCATGGGACCCAGG - Intergenic
1097360664 12:58655453-58655475 CCTTGGCAGGAGTGGGATCCAGG - Intronic
1097446392 12:59678006-59678028 CCTTGGCAGGTGTGATATTCAGG - Intronic
1097450568 12:59733265-59733287 CCTTGGCAGGTATGGGATCTGGG - Intronic
1097536041 12:60872325-60872347 CCTTGGCGGGCATAGGATTCAGG - Intergenic
1097573249 12:61357677-61357699 CTTTGGCAGGCCTGGGATCCAGG + Intergenic
1098356659 12:69618597-69618619 CCTTGACAGCTGTGGGATGATGG - Intergenic
1098802863 12:74984746-74984768 CCTTGGCAGGCATAGGATCCAGG - Intergenic
1099321889 12:81161750-81161772 CCTTGGCAGGCATGGGATCCAGG - Intronic
1099550161 12:84033497-84033519 CCTTGGCAGGTGTGAGATCAAGG + Intergenic
1099557697 12:84129596-84129618 ACTTGGCAGGTGTAGGATCCAGG + Intergenic
1099560849 12:84173124-84173146 CCTTGGCAGGTGTGAGATTCAGG - Intergenic
1099738706 12:86602170-86602192 CCTTGGCAGGTGTGGGATCCGGG + Intronic
1100672686 12:96834402-96834424 CCTTGGCAGGCATGGGATCCAGG - Intronic
1100848045 12:98679895-98679917 CCTTGGCAGGCTTGGGACCCAGG + Intronic
1100985721 12:100200047-100200069 ACTTGGCAGGTGCGGGAGGCAGG - Intronic
1101580761 12:106039378-106039400 CCTTGGCAGGTGTGGAATCTGGG - Intergenic
1103173825 12:118844507-118844529 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1103928280 12:124435671-124435693 CCTGGGCAGGCATGGGGTCCTGG - Intronic
1104272433 12:127294109-127294131 CCTTGGGAGGCGGGGGATGCAGG + Intergenic
1104738182 12:131152849-131152871 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
1104965838 12:132508472-132508494 CGTTGTCAGGCTTGGGGTGCAGG + Intronic
1105029672 12:132874018-132874040 CCTTGGCAGAGGTGGGCTGGAGG - Intronic
1105837696 13:24225168-24225190 CCTTGGCAGGCATGGGATCTGGG - Intronic
1106253375 13:28001132-28001154 CCTTGGCAGGTGTGGGATCTGGG - Intergenic
1106272289 13:28166516-28166538 CCTAGGCTGGTGTTGGATGCTGG + Intronic
1106325575 13:28685369-28685391 CCTTGGCAGGAATGGGATCTGGG + Intergenic
1106379684 13:29224065-29224087 CCTTGGCAGGAATGGGATCCAGG + Intronic
1106489984 13:30212456-30212478 CCTTGGCCGGCGTGGGATCAGGG + Intronic
1106999452 13:35526697-35526719 CCTTGGCAGGCATGGGATCTGGG - Intronic
1107171107 13:37342442-37342464 CCTTTGCAGGTGTGAGATCCAGG + Intergenic
1107243369 13:38264561-38264583 CCTTGGCTGGACTGGGATGGGGG - Intergenic
1107542382 13:41403241-41403263 CTTTGGCAGGAGTGGGATCCAGG - Intergenic
1107841300 13:44459918-44459940 CCTTGGCAGGCATGGGATCCAGG + Intronic
1108249731 13:48552002-48552024 ACTTGGCAGGTGTGGGATCTGGG + Intergenic
1108542289 13:51455629-51455651 ACTTGGCAGGTGTGGGATCCAGG - Intergenic
1108844185 13:54658816-54658838 CCTTGGCAGGCCTGGGATCCAGG - Intergenic
1108854299 13:54774670-54774692 CTTTGGCAGGCATGGGATCTAGG - Intergenic
1109348602 13:61146358-61146380 CCTTGGCAGGCATGGAATCTGGG + Intergenic
1109396360 13:61765432-61765454 TCTTGGTAGGCATGGGATTCAGG - Intergenic
1109426363 13:62169182-62169204 CCTTGGCAGGCATGGAATCCAGG + Intergenic
1109439027 13:62344301-62344323 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1109468230 13:62767634-62767656 CCTTGGCAGACGTAAGATCCAGG - Intergenic
1109622091 13:64924577-64924599 CCTTGGCAGACGTGGGACCCAGG - Intergenic
1109683406 13:65783455-65783477 CCTTGGCAGGTGCGGGATCTGGG - Intergenic
1109687923 13:65844686-65844708 CCTTGGCAGGCACGGGATCAAGG + Intergenic
1109837578 13:67878614-67878636 CCTTAGCAGGCATGGGATCTGGG + Intergenic
1109851941 13:68076280-68076302 CTTTGGCAGGCATGGGATCCAGG + Intergenic
1109982403 13:69925027-69925049 CCTTGGCAGGCATGGGATTCAGG + Intronic
1110343051 13:74414666-74414688 CCTTGGCAGGTATGGAATCCAGG + Intergenic
1110730611 13:78875883-78875905 CCTTCGCAGGCATGGGATCTGGG - Intergenic
1110810803 13:79808738-79808760 CCTTGGCAGGCGTGGGACCCAGG + Intergenic
1111002809 13:82206473-82206495 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1111072036 13:83182966-83182988 CCTTGGCAGGCTTGGGATCCAGG - Intergenic
1111091678 13:83453976-83453998 TCTTGGCTGGTGTGGGATCCAGG + Intergenic
1111192903 13:84832522-84832544 CCTAGGCAGATGTGGGATGCTGG + Intergenic
1111202687 13:84961192-84961214 CGTTGGCAGGTGTGGGATCCAGG - Intergenic
1111237894 13:85432066-85432088 CCTTGGCAGGCATGATATCCGGG + Intergenic
1111243867 13:85509132-85509154 CCTTGGCAGTTGTGGGATCTGGG + Intergenic
1111253545 13:85638377-85638399 CCTTGGCAGGCGTGGGAGCCAGG - Intergenic
1111304127 13:86383362-86383384 CCTTGGCAGGCATGGGATCTGGG + Intergenic
1111337037 13:86838519-86838541 CCTTGGCAGGCATAGGATCCAGG - Intergenic
1111474464 13:88726345-88726367 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1111485830 13:88896724-88896746 CCTTGGCAGTTGTGGGATCTGGG + Intergenic
1112086255 13:96034872-96034894 CCTTGGCAGGTGTGGGATCCAGG + Intronic
1112644814 13:101318221-101318243 CCTTGGTGGGCATGGGATCCAGG - Intronic
1113229477 13:108196041-108196063 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1113503228 13:110794388-110794410 CCTTGGCAGGTGTGGAATCTGGG + Intergenic
1113911493 13:113843442-113843464 CCGTGGCGGGGGTGGGATCCCGG + Intronic
1114980381 14:28157434-28157456 CCTCGGCAGGTGTGGGATCTGGG - Intergenic
1115059229 14:29169620-29169642 ACTTGGCAGGTGTGGGATCCAGG + Intergenic
1115310395 14:31973639-31973661 CCTTGGCAGGCATGGGATCTGGG - Intergenic
1115485137 14:33902596-33902618 CCTTGACAGGCATGGGATCCAGG + Intergenic
1116019455 14:39442492-39442514 CCTTAGTAGCCGTGGGATCCGGG + Intergenic
1116151139 14:41144536-41144558 CCTTGGCAGGTGTGGAATCTAGG - Intergenic
1116159847 14:41254055-41254077 CCTTGGCAGGCACGGGATCCAGG - Intergenic
1116167409 14:41350721-41350743 CCATGGCAGGTGTGGGATCTGGG + Intergenic
1116356878 14:43940085-43940107 CCTTGTCAGGCATGGGATCCAGG + Intergenic
1116617391 14:47155677-47155699 CCTTGACAGGTGTGAGATCCAGG + Intronic
1116789875 14:49329229-49329251 CCTTGGCATGCATGGGATTTGGG - Intergenic
1116961794 14:50974260-50974282 CCTTAGCAGGTGTGGGATCCAGG + Intergenic
1117412964 14:55467661-55467683 CCTTGGCAGGCATGGAATCCGGG - Intergenic
1117930996 14:60839904-60839926 CTTTGGCAGGTGTGGGATCTGGG + Intronic
1118463044 14:66004025-66004047 CCTTTACAGATGTGGGATGCAGG - Intronic
1118472977 14:66092856-66092878 CCTTGGCAGACGTGGGATCCAGG - Intergenic
1119998782 14:79279988-79280010 CCCTGACATGCGTGGCATGCCGG + Intronic
1120405866 14:84092254-84092276 TCTTGGCAGGCATGGGATCCAGG + Intergenic
1120444703 14:84579446-84579468 CCATGGCAGGTGTGGGATTCAGG + Intergenic
1121368790 14:93338063-93338085 CCTTGGCAAGCATGGGATCCAGG + Intronic
1121527897 14:94632310-94632332 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
1122298828 14:100720329-100720351 ACTTGGCAGGCATGGGATTGGGG + Intergenic
1122788377 14:104174276-104174298 CCTGCGCAGGCGGTGGATGCGGG - Exonic
1122815578 14:104310523-104310545 CCTTGGCAGTGCTGGGATGTAGG + Intergenic
1123025097 14:105420403-105420425 CCTTGGGAGGCGCCGGCTGCCGG + Intronic
1123064943 14:105613594-105613616 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123069144 14:105633047-105633069 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123074244 14:105659237-105659259 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123088241 14:105728820-105728842 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123094200 14:105758190-105758212 CCTGGTGAGGAGTGGGATGCCGG - Intergenic
1124069880 15:26381366-26381388 CGCTGCCAGGCGTGGGTTGCTGG + Intergenic
1125113929 15:36066953-36066975 GCTTGGCAGGCATGGGATCTGGG - Intergenic
1125195545 15:37041887-37041909 CCTAGGCAGGCTTGGCATGGTGG + Intronic
1125241695 15:37583164-37583186 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1125381439 15:39091582-39091604 CCCTTGGAGGCGTGGGATCCAGG - Intergenic
1125506926 15:40272466-40272488 CCTTGGCAACCGTGGGGTCCTGG - Exonic
1125718298 15:41832230-41832252 CCTTGGCAGGTGTGGGATCCAGG + Intronic
1125862212 15:43009454-43009476 CCTTGGCAGGCATGGGATCCAGG + Intronic
1126215347 15:46147203-46147225 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1127019244 15:54727430-54727452 CCTTGGCAAGCATGGGATCCCGG + Intergenic
1128434405 15:67631701-67631723 GCATGGCAGGACTGGGATGCTGG - Intronic
1128481917 15:68046690-68046712 CCTCGGCAGGGGAGGGATCCTGG + Intergenic
1128527887 15:68424768-68424790 CCTTGGCAGACTTGAGAAGCTGG - Intronic
1128720381 15:69943421-69943443 CTTGGGCAGGCCTGGGATACTGG + Intergenic
1128847995 15:70918237-70918259 CCTTAGCAGGCGTGGGACCCAGG + Intronic
1128965430 15:72052832-72052854 CTTTGGTAGGTGTGGGATCCAGG + Intronic
1129183683 15:73892696-73892718 CCTTGGCAAGTGTGGGCTCCAGG + Intergenic
1129377610 15:75144071-75144093 CCCTGGCAGGTGTGGGATCCAGG - Intergenic
1129591218 15:76916569-76916591 ACTTGGCAGGTGTGGGATCCGGG + Intergenic
1130227685 15:82072432-82072454 CCTTGGCAGGCGTGGGACCCAGG - Intergenic
1130253751 15:82316388-82316410 CCTTGGCAGGCGGGTCATCCAGG - Intergenic
1130738021 15:86570890-86570912 CCTTGGCAGGCATGGGATCCAGG - Intronic
1130872927 15:87985602-87985624 ACTTGGCAACCGTGGCATGCGGG - Intronic
1131568185 15:93505652-93505674 CCTTGGCAGGCGTGGGATCTGGG - Intergenic
1131605558 15:93899942-93899964 CCTGGGCAGGTGTGGGATCTGGG - Intergenic
1131999103 15:98162181-98162203 CCTTGGCAGGTATGGGATCCAGG - Intergenic
1132305459 15:100808540-100808562 CCTTGGCAGGTATGGGATCCAGG + Intergenic
1132392442 15:101449080-101449102 CCTTGGCATCCGTGGGGGGCTGG + Intronic
1132680800 16:1140973-1140995 CCTGGGCTCACGTGGGATGCTGG + Intergenic
1132986678 16:2770973-2770995 CCTTGGCAGCCCTTGGATGGAGG + Exonic
1133609471 16:7419419-7419441 CCAAGGCGGGAGTGGGATGCTGG - Intronic
1134361162 16:13532311-13532333 CCTTGGAAGGAGGGGGATACAGG + Intergenic
1137343985 16:47637381-47637403 CCTCGGCAAGTGTGGGATCCAGG + Intronic
1137588783 16:49680770-49680792 CCTTGGCAGGTATGGGATCCAGG + Intronic
1137596428 16:49727237-49727259 CCTCAGCAGGAGTGGCATGCCGG - Intronic
1137693060 16:50442507-50442529 TCTTGGCAGATGTGGGATCCAGG + Intergenic
1137747653 16:50834907-50834929 GCTTAGCAGCTGTGGGATGCTGG + Intergenic
1137937792 16:52651210-52651232 GGTGGGCAGGCATGGGATGCTGG - Intergenic
1138417792 16:56881121-56881143 CCTATGCAGGAGTGGGATGGGGG + Intronic
1138419915 16:56892535-56892557 CCTTGGCAGGGGTGGGACAAGGG - Intronic
1138878425 16:60980194-60980216 CCTTGGCAGGTGTGGGATTCAGG + Intergenic
1139015600 16:62685048-62685070 CCTTGGCAGGTGTGGGATCTAGG + Intergenic
1139088377 16:63616450-63616472 CCTTGGCAGTTGTGGGATCTGGG - Intergenic
1139151085 16:64382211-64382233 CCTTGGCAGGTGTGGGGTCCAGG + Intergenic
1139183242 16:64771475-64771497 TCTTGGCAGGCATGGGATCTAGG + Intergenic
1139463497 16:67141539-67141561 CCTTGGCAGGCATGGGATCCAGG - Intronic
1139625685 16:68187026-68187048 CCTTTGCAGGCATGGGATCCAGG - Intronic
1139689330 16:68629833-68629855 CCCTGGCAGGTGTGGAATGGAGG + Intergenic
1140103623 16:71939301-71939323 TCTTGGCAGGTGTGGGATCCAGG + Intronic
1141687830 16:85580401-85580423 CCTTGGCGGGGTTCGGATGCTGG - Intergenic
1142212186 16:88813455-88813477 CCTGGGAAGGCGTGGGGTGGGGG + Intergenic
1203139204 16_KI270728v1_random:1748687-1748709 CCTTGGCTGGCTTGGCTTGCTGG - Intergenic
1143922779 17:10343977-10343999 CTTTGGCAGGCTTGGGCTTCTGG + Exonic
1143933555 17:10457597-10457619 CTTTGGCAGGCTTGGGCTTCTGG + Exonic
1143938137 17:10508540-10508562 CTTTGGCAGGCTTGGGCTTCTGG + Exonic
1144390107 17:14785155-14785177 CCTTGGCAGGTTTGGGATCCAGG + Intergenic
1144714635 17:17425339-17425361 CCTTGCCAGGCATGGGATCCAGG + Intergenic
1146087070 17:29839275-29839297 CCTTGGCAGGTATGGGATCCAGG + Intronic
1146359318 17:32160821-32160843 CTTTGGCAGGCGTGGGATCCAGG + Intronic
1146425436 17:32733119-32733141 CCTTGGCAAGTGTGGAATCCAGG + Intronic
1146774030 17:35596576-35596598 GCCTGGCAGGCGCGGGATGACGG - Intronic
1148168491 17:45500916-45500938 CCATGGCAAGCGGTGGATGCAGG - Intergenic
1148280321 17:46342024-46342046 CCATGGCAAGCGGTGGATGCAGG + Intronic
1148302549 17:46559961-46559983 CCATGGCAAGCGGTGGATGCAGG + Intronic
1148469078 17:47882431-47882453 CCTTGGCAGGGGTGGGAAACCGG + Intergenic
1149238101 17:54616666-54616688 CTTTGGCAGGTGTGGGATCCAGG + Intergenic
1150201364 17:63361331-63361353 CCTTGGGAGGTGTGGGATCTGGG - Intronic
1150399684 17:64847367-64847389 CCATGGCAAGCGGTGGATGCAGG - Intergenic
1150529318 17:65959855-65959877 CCTTGGCAGGTGTTGGATACAGG + Intronic
1150868732 17:68880777-68880799 TCTTGGCAGGCTTGGGATCCAGG + Intronic
1152472682 17:80499174-80499196 CCCTGCCAGGGGTGGGAAGCAGG - Intergenic
1152528558 17:80903438-80903460 CCTGGGCAGGCCTGGGGTGCAGG - Intronic
1152530604 17:80916499-80916521 CTTTGGCAGGTGTGAGATGCGGG + Intronic
1152755620 17:82085821-82085843 GCTGAGCAGGCCTGGGATGCGGG + Exonic
1153427840 18:4986786-4986808 CCTTGGCAGGCATGGGATCTGGG - Intergenic
1153428684 18:4992277-4992299 CCTTGACAGGCATGGGATCCAGG - Intergenic
1153473278 18:5469539-5469561 CCTTGACAGGTGTGGGATCTGGG + Intronic
1153608316 18:6855973-6855995 CCTTGGCAGGCGTGGGATCTGGG + Intronic
1153724111 18:7937505-7937527 CCTTGGCAGGCATGGAATCCAGG + Intronic
1154346473 18:13547530-13547552 CCTTGACAGGTGTGGGATCTGGG - Intronic
1154357370 18:13632294-13632316 CCTTGGCAGGTGTGGGATCTGGG - Intronic
1154508071 18:15061782-15061804 CCTTGGGAGGCATGGGATACAGG + Intergenic
1155215900 18:23642535-23642557 CCTTGGCAGGCATGGGACCTGGG + Intronic
1155819310 18:30353716-30353738 CTTTGACAGGTGTGGGATCCAGG + Intergenic
1156244304 18:35283495-35283517 CCTTGGCAGGGGCGAGATACAGG - Intronic
1156327408 18:36086412-36086434 CCTTAGCAGACATGGGATCCGGG + Intergenic
1157006293 18:43588941-43588963 CCTTGGCAGGCATAGGATCCAGG - Intergenic
1157506804 18:48232042-48232064 CCTTGGCAGGCGTGGGATCCAGG + Intronic
1158139313 18:54240880-54240902 CCTTGGCAGACATGGGATCCAGG - Intergenic
1158774226 18:60556568-60556590 CCTTGACAGGCATGGGATCTGGG + Intergenic
1158788160 18:60740639-60740661 CCTTGGCAGGTATGAGATCCAGG + Intergenic
1158888990 18:61855723-61855745 CCTTGGCAGGTGTGGAATCTGGG + Intronic
1159161207 18:64645910-64645932 CCTTGGCAGGTGTGGGACTCGGG - Intergenic
1159188935 18:65017069-65017091 CCTTGGCAGGCATGTGATGTAGG - Intergenic
1159292548 18:66440625-66440647 CCTTGGCAGTCATGGGATCCAGG + Intergenic
1159518960 18:69494951-69494973 ACTTGGCAGGTGTGGGATCCAGG - Intronic
1159849809 18:73514558-73514580 CCTTGGCAGGCATGATATTCAGG - Intergenic
1160052969 18:75454695-75454717 CCTGGGCAGGCGAGGGTTCCGGG - Intergenic
1160474042 18:79166849-79166871 CCTCGGCAGGCGTGGGATCCGGG - Intronic
1160837749 19:1132619-1132641 GCTTGGCATGCGTGGGGTGCTGG - Intronic
1160995986 19:1882068-1882090 CCATGGCATGCGGGGCATGCAGG + Intronic
1161153763 19:2721916-2721938 CCTGGGCAGGGGCGGGATGGGGG + Intronic
1161451118 19:4345948-4345970 CCGTGGCAGGCGTGTGCAGCTGG - Exonic
1161780352 19:6287529-6287551 CCTTGGCAAGTGTGAGATCCAGG + Intergenic
1161781947 19:6298671-6298693 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1163267973 19:16233086-16233108 CCGTGGCAGGGGAGGGCTGCTGG - Intronic
1164984565 19:32638866-32638888 CCTTGGCAGGCATGGGATCCAGG + Intronic
1165221107 19:34317438-34317460 CCTTGGCAGCTATGGGAAGCTGG - Intronic
1167321252 19:48798407-48798429 CCCAGGCAGGCCTGGAATGCCGG - Intronic
1167649788 19:50723048-50723070 TCTCGGCAGTGGTGGGATGCTGG - Intergenic
1167693958 19:51003204-51003226 CCTTGGCAGGCGTGGTGTCTGGG - Exonic
1168630025 19:57949405-57949427 CCTTGGTAGGTGTGGGATCCAGG - Intergenic
1202686543 1_KI270712v1_random:55101-55123 TCTTGGCTGGCTTGGGTTGCTGG + Intergenic
925030287 2:645202-645224 CCTTAGCAGGCGAGTGAGGCCGG - Intergenic
925515445 2:4675578-4675600 CCTTGGTAGGCATGAGATCCAGG + Intergenic
926070376 2:9884015-9884037 CCTTGGCAGGCATGAGACCCAGG - Intronic
926554684 2:14342584-14342606 CCTTAGCAGGCATGAGATCCAGG + Intergenic
926675670 2:15618452-15618474 CCTTGGGAGGCATGGGGTCCAGG - Intronic
927093319 2:19728773-19728795 CCTTGGCAGCCGCTGGAAGCAGG + Intergenic
927236345 2:20879335-20879357 CCATGGCAGGCATGGGATCCAGG - Intergenic
927302875 2:21536195-21536217 CATGGGCTGGCGTTGGATGCCGG - Intergenic
927509255 2:23634257-23634279 CCTTGGCAGGAGAGGGCTGTGGG + Intronic
927533711 2:23836108-23836130 CCCTGGCAGGCATGGGATACAGG - Intronic
927613439 2:24565691-24565713 CCTTGGCAGGCATGGGATCCAGG - Intronic
927666277 2:25035147-25035169 CCTTGGCTGTGGTGAGATGCAGG + Intergenic
927743039 2:25589884-25589906 CCTTGGTAGGCATGGGATCCAGG - Intronic
928470136 2:31567892-31567914 CCTTGGCAGGTGTGGGATCCAGG - Intronic
928638018 2:33267265-33267287 CCTTGGCAAGTGTGGGATCTGGG + Intronic
928820399 2:35355193-35355215 CCTTGGTAGGCATGGGATATGGG - Intergenic
929896568 2:45966072-45966094 CCTTGGGAGGCGTGGATGGCTGG + Intronic
930729146 2:54710444-54710466 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
930957397 2:57218453-57218475 TCTTGGCAGGTGTGGGATGCAGG + Intergenic
930971060 2:57396818-57396840 CCTTGGCAGGCATGGGATCCAGG - Intergenic
931005692 2:57848872-57848894 CCTTTGCAGGTGTGGGATCCAGG - Intergenic
931500214 2:62856546-62856568 CCTTGGTAGGCATGGGATCCAGG + Intronic
932054579 2:68431784-68431806 CCTTGGCAGGCATGGGATCCAGG - Intergenic
932398118 2:71462142-71462164 CCTTCGCAGGCGTGGGATCAGGG - Intronic
932972630 2:76563924-76563946 GCATGGCAGGCATGGGATCCAGG - Intergenic
933063750 2:77769244-77769266 CCTTGTCAGGTGTGGAATCCAGG + Intergenic
933455044 2:82508926-82508948 CCTTGGCAGGCATGGGATCTGGG + Intergenic
933801010 2:85960573-85960595 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
933961047 2:87408116-87408138 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
933961265 2:87409101-87409123 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
933961559 2:87410433-87410455 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
933961697 2:87411074-87411096 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
933961836 2:87411723-87411745 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
933962285 2:87413867-87413889 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
933963813 2:87420561-87420583 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
933964524 2:87423907-87423929 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
933965134 2:87426664-87426686 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
933965270 2:87427314-87427336 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
933965921 2:87430155-87430177 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
934243176 2:90289175-90289197 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
934243381 2:90290146-90290168 TCTTGGCTGGCTTGGGTTGCTGG - Intergenic
934264241 2:91500999-91501021 GCTTGGCTGGCTTGGCATGCTGG + Intergenic
934268049 2:91518812-91518834 CCTTGGCTGGCTTGGGTGGCTGG + Intergenic
934570843 2:95372414-95372436 GCTTGCCTGGCGTGGGATGCTGG + Intronic
934700040 2:96431544-96431566 CCTTGGCAGGCGTGGGACCCAGG + Intergenic
934948254 2:98557851-98557873 CCTTGGCAGGCGGGGGTGGAGGG - Intronic
935518635 2:104077597-104077619 CCTTGGCAGACATGGGATCCAGG - Intergenic
937163902 2:119794369-119794391 CCTTGGCAGGTGTGGGATCCAGG - Intronic
937167960 2:119837981-119838003 CCTTGGCAGGTGTGGAATCCAGG + Intronic
937370704 2:121295511-121295533 CCTTAGCAGGTGTGGGATCCAGG - Intergenic
937543860 2:122990340-122990362 CCTTGGCAGGCATGGGATCCAGG + Intergenic
938096306 2:128466487-128466509 CCTTGGCAGGCATGGGATCCAGG - Intergenic
938114015 2:128591229-128591251 CCGTGGCAGGGGCGCGATGCAGG - Intergenic
938180527 2:129178481-129178503 CCTTGGCAGGCCTGGGACCCGGG - Intergenic
938421999 2:131153618-131153640 CCCTGGCAGGCGTGCTAGGCAGG + Intronic
938721968 2:134075428-134075450 CCTTGGCAGGCATGAGATTTGGG - Intergenic
939017501 2:136919739-136919761 CCTTGGTAGGTGTGGGATCCAGG - Intronic
939466537 2:142563133-142563155 CCTTGGCAGGCATGGGATCTGGG + Intergenic
939802034 2:146721703-146721725 CCTTGGCAGGCATGAGATTCGGG + Intergenic
940398539 2:153221648-153221670 CCTTGGCAGGCGGGGGATCCAGG - Intergenic
940582443 2:155599950-155599972 CCTTGGCAGGCATGGGATCCAGG - Intergenic
940612079 2:156005660-156005682 CCCTTGGAGGCGTGGGATCCAGG - Intergenic
941131201 2:161651824-161651846 CCTTGGCAGGTGTGGGATCCAGG + Intronic
941151532 2:161920126-161920148 CTTTGGCAGGCCTGGGATCCAGG + Intronic
941432457 2:165427953-165427975 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
941852780 2:170200914-170200936 CCTTCGCAGGGATGGCATGCAGG - Intronic
941929033 2:170923154-170923176 CCTTGTCAAGTGTGGGATCCAGG - Intergenic
942315517 2:174693346-174693368 CCCTGGCAGGCGTGGGATCTGGG + Intergenic
943129463 2:183838492-183838514 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
943180108 2:184530289-184530311 CTTTAGCAGGTGTGGGATCCAGG - Intergenic
943191562 2:184685035-184685057 TCTTGGCAGGTGTAGGATCCAGG - Intronic
943345494 2:186733583-186733605 CCTTGGCAGGCATGGGATCCAGG - Intronic
943426874 2:187749125-187749147 CCTTGGCAGGGATGGGATCCAGG - Intergenic
943827621 2:192415023-192415045 CCTTGGCAAGTGTGGGATCCGGG + Intergenic
943858557 2:192829186-192829208 CCTTGGCAGACGTGGGATCTGGG + Intergenic
943960348 2:194255279-194255301 CCTTGGCAGCTGTGGGATCCAGG + Intergenic
943965701 2:194328768-194328790 CCTTGGCAGGCATGAGATCCAGG + Intergenic
945394872 2:209305876-209305898 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
945770279 2:214034505-214034527 CCTTGGCAGGCATGCAATCCAGG - Intronic
946705812 2:222457829-222457851 CCTGTGCAGGCCTGGGATGCAGG + Intronic
947054693 2:226087239-226087261 CCTTGGCAGGTATGGGATCCAGG - Intergenic
947327114 2:228991566-228991588 CCTTGTGAGGCATGGGATCCAGG - Intronic
948713314 2:239839484-239839506 CCTTGGCAGGTGTGAGATCCAGG + Intergenic
948782037 2:240327771-240327793 CTTTGGCAGGCCTGGGATCCAGG + Intergenic
949045186 2:241869671-241869693 GATTGGCCGGCGCGGGATGCGGG + Intronic
1168983285 20:2026124-2026146 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
1169270040 20:4192203-4192225 GCTGGGCAGGAGTGGGATGGGGG + Intergenic
1169309471 20:4522520-4522542 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
1169339355 20:4784377-4784399 CCTGGGCAGGGGTGTGTTGCTGG - Intronic
1169421682 20:5465567-5465589 CCTCGGCAGGCATGGGATCTGGG + Intergenic
1169617244 20:7462334-7462356 CCTTGACAGGCACGGGATGGGGG + Intergenic
1169880639 20:10342422-10342444 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1170043717 20:12064610-12064632 CCTTGGCAGGCATGGGACCCAGG - Intergenic
1170221691 20:13947964-13947986 CCTTGGCAGTTGTGGGGTCCAGG + Intronic
1170314793 20:15030991-15031013 CCTTGGCAGGTGTGGGATCTGGG - Intronic
1170327980 20:15177127-15177149 CTTTGGTAGGTGTGGGATCCAGG + Intronic
1170458514 20:16554988-16555010 CCTTGGCAGGCATGGGATCCAGG + Intronic
1170501174 20:16975982-16976004 CCTTGGCAGGCATGGGATCTAGG + Intergenic
1171286140 20:23939238-23939260 CCTTGGCAGGTGTGGAATCTGGG + Intergenic
1172347160 20:34210552-34210574 CTTTGGCAGGCATGGGATCCAGG + Intronic
1172763886 20:37340618-37340640 CCTGGGCTGGGGTGGGATGGTGG + Intergenic
1172958797 20:38782390-38782412 CCCTGGCAGGTGTGGGAGGGAGG - Intergenic
1173207463 20:41006288-41006310 CCTTGGCAGGCAGGGGATCCAGG - Intergenic
1173740285 20:45395302-45395324 CCTTGGTAGGCATGGGATCCGGG + Intronic
1175211838 20:57363267-57363289 CTTTGGGAGGCTTGGGATGAAGG + Intronic
1175283348 20:57820145-57820167 CCATGGGAGGCCTGGGAGGCTGG + Intergenic
1175959778 20:62630134-62630156 CCTCAGCAGGTGTGGGATCCAGG - Intergenic
1176022270 20:62967883-62967905 CATTGGCAGGCGGGCGCTGCAGG - Exonic
1176408555 21:6435158-6435180 CCTTGGTAGGCATGGGACCCAGG + Intergenic
1176790007 21:13310017-13310039 CCTTGGGAGGCATGGGATACAGG - Intergenic
1176973128 21:15289323-15289345 CCTTGGCAGGCATGGGATCCAGG - Intergenic
1177344522 21:19853204-19853226 CCTTGGCAGGCATGGGATCTGGG - Intergenic
1177687439 21:24456568-24456590 CTTTGGCAGGCATGGGATCCAGG - Intergenic
1177989192 21:28018224-28018246 CCTTGGGAGGCATGGGATACAGG - Intergenic
1178937565 21:36876164-36876186 CCGTGGCAGGCATGGGATCCAGG + Intronic
1179400203 21:41076271-41076293 CCTTGGCAGGTGTGAGATCTGGG + Intergenic
1179684047 21:43043480-43043502 CCTTGGTAGGCATGGGACTCAGG + Intergenic
1180025999 21:45162421-45162443 CCTTGGCAGGCATGGGATCCAGG + Intronic
1180698323 22:17768424-17768446 CCTGGGCAGGGGAGGGAGGCAGG - Intronic
1180738517 22:18036585-18036607 CCTTGGCTGGCCTGGGATGCAGG + Intergenic
1181013863 22:20057281-20057303 ACTGGGCAGACGTGGGAAGCTGG - Intronic
1182649190 22:31836911-31836933 CCATGGCAAGTGTGGGATGGGGG - Intronic
1183024839 22:35057391-35057413 CCTTGGCAAGCATGGGATCTAGG - Intergenic
1183075776 22:35426005-35426027 CCTCGGCCTGAGTGGGATGCTGG + Intergenic
1184054126 22:42033073-42033095 CCTTGGCAGGCATGGGATCCAGG - Intronic
1184560775 22:45261811-45261833 CCTTGGTAGACGTGGGATCCAGG - Intergenic
1184739258 22:46417662-46417684 CCCTGGCAGGTGAGGGATTCAGG - Intronic
949218420 3:1600320-1600342 CCCTTGGAGGCGTGGGATCCAGG - Intergenic
950994620 3:17481307-17481329 CCTTGGAAGGCATGGGATTTGGG + Intronic
951508778 3:23479179-23479201 CCTTGGCAGATGTGGGATCCAGG - Intronic
951509533 3:23486102-23486124 CCTTGGCAGGTGTGGGATCCAGG - Intronic
951562294 3:23981273-23981295 CCCTTGGAGGCGTGGGATCCAGG - Intergenic
951566672 3:24018890-24018912 CCTTGGCAGGCGTGGGATCCAGG - Intergenic
951718326 3:25673015-25673037 CCTTGGCAGGCATAAGATCCAGG - Intergenic
952408680 3:33027367-33027389 CCTTGGCAGGTATGGGATCCAGG + Intronic
953289984 3:41650636-41650658 CTTTGGCAGGCATAGGATCCAGG + Intronic
953603186 3:44387670-44387692 CCTTGGCAGATGTGGGATCTGGG + Intronic
953766695 3:45748247-45748269 CCTTGGCAGGCATGGGATCCAGG + Intergenic
953901219 3:46845300-46845322 CCTGGGCAGGGCTGGGGTGCGGG + Intergenic
954125366 3:48525086-48525108 CCATGGCAGGCCTGGGACTCGGG - Intronic
954300551 3:49698746-49698768 TCATGGCAGGCGTGGGCAGCGGG + Exonic
954498162 3:50984113-50984135 CCTTGGCAGGTGTGGGATCCAGG + Intronic
954737209 3:52716166-52716188 CCTTGGCAGGCATGGGATACAGG + Intronic
955303931 3:57810310-57810332 CGTTGGCAGGCATGGGATCCAGG + Intronic
955411481 3:58658211-58658233 CAATGGCAGGCCTAGGATGCGGG + Intronic
955769577 3:62373982-62374004 CCTTGGCTGGCGTCGGAGGTCGG + Intronic
956989850 3:74751054-74751076 CCTCGGCAGGCATGGGATCCAGG - Intergenic
957307901 3:78481288-78481310 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
957418032 3:79930398-79930420 CCTTGGCAGGTGTGTGATCCAGG + Intergenic
957636488 3:82791529-82791551 CCTTTGCAGGCATGGAATCCAGG + Intergenic
957653060 3:83034887-83034909 CCTTGGCAGGCGTGGAATCCAGG - Intergenic
957665043 3:83217035-83217057 TTTTGGCAGGTGTGGGATCCCGG - Intergenic
957788108 3:84906270-84906292 CCTTGACAGGCATGGGAAACAGG + Intergenic
958019202 3:87977956-87977978 CCTTGGCAAGCATGGGATCTGGG - Intergenic
958593502 3:96190538-96190560 CCATGGCAGGTGTGAGATCCAGG + Intergenic
958977550 3:100683620-100683642 CCTTGGCAGGTGTGGGATCCAGG + Intronic
959476928 3:106822502-106822524 CCTTGGCAGGCATGGGATCCAGG + Intergenic
959863539 3:111242068-111242090 CCTTGGCAGGCATGGGATCCAGG - Intronic
959897231 3:111618166-111618188 CCTTGGCAGGTGTGGGATCCAGG + Intronic
960011005 3:112834707-112834729 CCTTGGCAGATGTGGGATCCAGG - Intronic
961381182 3:126497505-126497527 ACCTGGCAGGCGTGGAAGGCTGG + Intronic
961525948 3:127497398-127497420 CTTTGGCAGGCATGGGATCCAGG + Intergenic
961599153 3:128045691-128045713 CCTTGGTATCCGTGGGATGTTGG - Intergenic
961942844 3:130655875-130655897 CCTTGGCAGGTATGAGATTCAGG - Intronic
962105031 3:132381497-132381519 CCTTGACAGGTGTGGGACCCAGG - Intergenic
963204310 3:142616843-142616865 CCTTGGGAGGCCTGGGCTGATGG - Intronic
963487336 3:145951901-145951923 CCATGTCAGGGGTGGGATACAGG - Intergenic
963905968 3:150773976-150773998 CCTTGGCAGGTATGGGATCTGGG - Intergenic
964254916 3:154765730-154765752 CCTTGGCAGATGTGGGATCCAGG - Intergenic
964927694 3:161977961-161977983 TGTTGGCAGGTGTGGGATCCGGG - Intergenic
964996916 3:162892614-162892636 CCTTGGCAGGCATGGGATCCAGG + Intergenic
965009930 3:163074197-163074219 CCTTGGCAAGCGTGGGATCTGGG + Intergenic
965056303 3:163721649-163721671 CCTTGGCAGGCATGGGATCCAGG - Intergenic
965073859 3:163952673-163952695 CCTTGGCAGGTCTGGGATCCTGG - Intergenic
965205089 3:165712442-165712464 CCTTGGCAGGCATGAAATCCAGG - Intergenic
965229049 3:166028224-166028246 CCTTGGCAGGTGTGGGATCTGGG - Intergenic
965290040 3:166866224-166866246 CCTTGGCAGAGATGGGATGCAGG + Intergenic
965309761 3:167114775-167114797 CCCTTGGAGGCGTGGGATCCAGG - Intergenic
965367896 3:167821589-167821611 CCTTGGCAAGTGTGGGATCCGGG + Intronic
965924175 3:173957879-173957901 TCTTGGCAGGTGTGGGATCCAGG - Intronic
965984520 3:174735902-174735924 CCTTGGCAAGCATGGGATCCAGG - Intronic
967649758 3:191972721-191972743 CCTTGGCAGGCGTGGGATCCAGG - Intergenic
967962910 3:194939902-194939924 CCATGACAGGCCTGGGTTGCTGG + Intergenic
968096005 3:195931286-195931308 CCTGGGCAGGGGTGGGGTGGGGG - Intergenic
968149695 3:196327419-196327441 CCTTGGCAGGCATGCCATGCTGG - Exonic
968164420 3:196452916-196452938 CCTTGGCAAGCATGAGATCCAGG - Intergenic
968538497 4:1150193-1150215 TCTTGGCAGGTGTGGGATCCAGG - Intergenic
968980650 4:3847665-3847687 CATTGGCAGGCGTGGGATCCGGG - Intergenic
969194313 4:5548144-5548166 CTTTGGCAGGCATGGGATCTAGG + Intronic
970959798 4:21858130-21858152 CCTTGGCAGATATGGGATCCAGG + Intronic
971092547 4:23361680-23361702 CCTTGGCAGATGAGGGATCCAGG + Intergenic
971669696 4:29541929-29541951 CCTTAGCAGGTGTGGGATCTGGG - Intergenic
971876717 4:32318150-32318172 CCTTGGCAGGCATGGGATCTGGG - Intergenic
972075447 4:35080278-35080300 CCTTGGCCGGCATGGGATCTGGG + Intergenic
972106602 4:35495269-35495291 CCTTGGCAGGTGTGGCATCCAGG + Intergenic
972322769 4:37987976-37987998 CAGTAGCAGGCGTGGGGTGCAGG + Intronic
972645967 4:40967682-40967704 TTTTGGCAGGTGTGGGATCCAGG + Intronic
972788332 4:42347315-42347337 CCTTGGCAGGCATGGGATCTGGG + Intergenic
973041293 4:45472737-45472759 CCTTGGTAGGAATGGGATTCAGG + Intergenic
973534395 4:51866970-51866992 ACTTGGCAGGTGTGGGATCCAGG - Intronic
974023572 4:56712323-56712345 CCTTGGCAGGCATGGGATCCAGG + Intergenic
974420281 4:61663545-61663567 CCTAGGCAGGTGTGGGATCTAGG + Intronic
974515184 4:62898388-62898410 CCTTGGCAGGCATGGGGTCAGGG + Intergenic
974552509 4:63396431-63396453 CCATGGCAGGCATGGGATCTGGG + Intergenic
974683364 4:65194114-65194136 CCTTGGCAGGCGTGGGATCCAGG - Intergenic
974686686 4:65241304-65241326 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
974894998 4:67927550-67927572 CCTTGGTGGGCATGGGATCCAGG + Intronic
975008593 4:69321483-69321505 CCTTGGCAGGTGTGGGATCTGGG + Intronic
975023671 4:69521615-69521637 TGTTGGCAGGTGTGGGATCCAGG + Intronic
975040741 4:69742737-69742759 CCTCGGCAGGCATGAGATCCAGG - Intronic
975254223 4:72215351-72215373 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
975498447 4:75058740-75058762 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
976097698 4:81527288-81527310 CCTTGACAGGCATGGGATCCGGG - Intronic
976178837 4:82380536-82380558 CCTTGGCAGGCATGAGATCTGGG - Intergenic
976510983 4:85909974-85909996 CCTTGGCAGGCGTGGGATCCAGG - Intronic
976729285 4:88245526-88245548 TCTTGGCATGCATGGGATCCAGG + Intergenic
976734393 4:88295819-88295841 CCTTGGCAGGCATGGGATTCAGG - Intergenic
977410419 4:96654339-96654361 CCTTGGCAGGTGCGGGATCTGGG + Intergenic
977471998 4:97453382-97453404 CCTTGGCAGGCATGGGATCCAGG + Intronic
977487207 4:97664861-97664883 CCTTGGCAGGCATGGGATCCAGG - Intronic
977816106 4:101416094-101416116 CCTTGGCAGGTGTGGGATCCAGG - Intronic
978061654 4:104346068-104346090 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
978149226 4:105414435-105414457 CCTTGGCATGCGTGGGATCCAGG - Intronic
978300923 4:107269321-107269343 CCTTGGCAGGTGTGGGATCCAGG - Intronic
978347514 4:107787818-107787840 CCTCGGCAGGTGTGGGAGCCAGG - Intergenic
978466871 4:109017308-109017330 CCTTGGCATGTGTGGGACCCAGG + Intronic
978498621 4:109385459-109385481 CCTTGGCAGGCATGGGATCCAGG + Intergenic
979090439 4:116477162-116477184 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
979448087 4:120838848-120838870 CCTTGGCAGGTGTGGAATCCAGG - Intronic
979637745 4:122977273-122977295 CCTTGGCAGGTGTAGGATCCAGG - Intronic
979648828 4:123106835-123106857 CCTTGGCAGGTGTGGGATTAAGG - Intronic
979956279 4:126956708-126956730 CCTTGGCAGGTATGGGATCCAGG + Intergenic
980282476 4:130738373-130738395 CCTTGGCAGGCATGGGATACAGG + Intergenic
980282487 4:130738433-130738455 CCTTGGCAGGCATGAGATCCGGG + Intergenic
980306135 4:131064040-131064062 CCTTGGAAGGCTTGGGATCCAGG - Intergenic
980308602 4:131099126-131099148 CCTTGGCAGGTATGGGATCTGGG - Intergenic
980450346 4:132960636-132960658 CCTTAGCAAGTGTGGGATCCAGG + Intergenic
980493388 4:133560132-133560154 CCTCGGCAGGCATGAGATTCAGG - Intergenic
980582836 4:134775026-134775048 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
980703257 4:136458571-136458593 CCTTGGCAGGCATGGGATCCAGG + Intergenic
980745129 4:137002155-137002177 CCATGGCAGGTGTGAGATTCAGG + Intergenic
981727207 4:147861106-147861128 CCTTGGCAGGCATGAGATCCAGG - Intronic
981889071 4:149715221-149715243 CCTTGGCAGGCATGGGATCTGGG - Intergenic
982157906 4:152539680-152539702 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
982545340 4:156725473-156725495 CCTTGGCAGGCATGGGATCCAGG + Intergenic
982611193 4:157575594-157575616 CCTTGGCAGGTATGGGATTCAGG + Intergenic
982802464 4:159722187-159722209 CCTCGGCAGGCATGGAATCCGGG - Intergenic
982856093 4:160384867-160384889 CCTTGGCAGGCATGGGATCTAGG - Intergenic
982900906 4:161002501-161002523 CCTTGGCAGGCATGGGATCCAGG - Intergenic
982918776 4:161249035-161249057 CTTTGGCAGATGTGGGATCCAGG - Intergenic
983069585 4:163253375-163253397 CCTTGGCAGACATGGGATCCAGG - Intergenic
983323916 4:166228352-166228374 CTTTGGCAGGCATGGGATCCGGG + Intergenic
983379976 4:166980548-166980570 CCTTGGCAGGTGTGGGATCTTGG - Intronic
983431139 4:167652506-167652528 CCTTGGCAGGCACGGGATCCAGG + Intergenic
983784703 4:171716303-171716325 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
983885280 4:172974698-172974720 CCTTGACAGGCATGGGATTCAGG - Intronic
984169307 4:176342523-176342545 CCTTGGCAGGTGAGGGATCCAGG - Intergenic
984296805 4:177862925-177862947 CCTTGGTAGGCATGGGATCCAGG + Intronic
984337979 4:178416170-178416192 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
984375461 4:178923106-178923128 CCTTGGCAGGTGTGTGATTCTGG + Intergenic
984763946 4:183385221-183385243 CTTTGGCAGGCATGTGATCCTGG + Intergenic
984952299 4:185016788-185016810 CCTTGGCAGGGGTGGGTAGGCGG - Intergenic
985916384 5:2921875-2921897 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
987537827 5:19209812-19209834 CCTTGGCAGGCATGGGATCTGGG + Intergenic
987875534 5:23675668-23675690 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
988093097 5:26568418-26568440 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
988110077 5:26808075-26808097 CCTTGGCAGGCTTGGGATCTGGG + Intergenic
988202428 5:28084296-28084318 CCTTGGCAGGCGTGGGATCCAGG + Intergenic
988225356 5:28405152-28405174 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
988346480 5:30042989-30043011 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
988928822 5:36015638-36015660 CCTTGGGACGATTGGGATGCTGG + Intergenic
989439913 5:41458124-41458146 CATTAGCAGGCGTGGGATGAGGG - Intronic
989520806 5:42397447-42397469 CCTTGGCAGGTGCGGGGTCCAGG + Intergenic
989537736 5:42582972-42582994 CCTTGGCAGGCATGGGGTCCAGG + Intronic
989732609 5:44665520-44665542 CCTTGGCAGGCATAGGATCCAGG + Intergenic
989821824 5:45801468-45801490 CCTTGGCGGGTGTGGAATCCAGG + Intergenic
991359133 5:65802196-65802218 CCTTGGCAGGCATGGGATCCAGG - Intronic
991429603 5:66530467-66530489 CATTGGCAGGCCTAGGATCCAGG - Intergenic
992029552 5:72708222-72708244 CCTTGGCAGGTATGGGATCTGGG - Intergenic
992191237 5:74294205-74294227 CCTTGGCAGAGGTGGGTGGCAGG - Intergenic
993236076 5:85311830-85311852 CATTGCCAGGCATGGGATTCAGG + Intergenic
993617898 5:90136108-90136130 CCTTCGCAGGTGTGGGATCTTGG - Intergenic
993703221 5:91142967-91142989 CCTTGGCAGGCATGGGATCCAGG - Intronic
994451689 5:99951428-99951450 TCTTGGCAGGCATGGCATCCAGG + Intergenic
994518094 5:100795037-100795059 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
994692229 5:103033784-103033806 CCTTGGCAGGCATGGGATCCGGG - Intergenic
994753091 5:103763498-103763520 CCTTGGCAGGCATAGGATCTGGG - Intergenic
994948245 5:106423760-106423782 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
995146146 5:108788364-108788386 CCTTGGCATGTGTGGGATCCAGG + Intronic
995386509 5:111595604-111595626 CCTTGGCAAGTGTGGGATTCAGG - Intergenic
995724137 5:115167006-115167028 CGTTGGCAGCCGTGGGATCTGGG + Intronic
995742554 5:115369662-115369684 CCTTGGCAGGTGTAGGATCCAGG + Intergenic
996183653 5:120451067-120451089 CCTTGGCAGGCATGGGATCCAGG - Intergenic
997042671 5:130277152-130277174 CCTTGGCAGGTGTGGGATCTGGG - Intergenic
997984380 5:138491598-138491620 CCTTGCCAGCCGGGTGATGCTGG - Intergenic
1000244098 5:159434627-159434649 GCTTTGCAGGGGTGGGATGGGGG + Intergenic
1000266409 5:159641894-159641916 CCTTGGCAGGCATAGGATCCAGG + Intergenic
1000472382 5:161661060-161661082 CCTTGGCAGGCATGGGATCCAGG + Intronic
1001734803 5:173989177-173989199 ACTGTGCAGGCGAGGGATGCGGG - Exonic
1002072284 5:176687415-176687437 CCTTGGCAGATGTGGGATCCAGG - Intergenic
1002660411 5:180787763-180787785 CCTTGGCAGGCTTCTCATGCAGG + Intergenic
1003439132 6:6123022-6123044 CCTTGGTAGGTGTGGGATCTGGG + Intergenic
1003711171 6:8591959-8591981 ACTTTGCAGGGGTGGGCTGCAGG + Intergenic
1003985029 6:11426788-11426810 CCTGGGGAGGCGTGGGGTGGGGG + Intergenic
1004304646 6:14488620-14488642 CCTTGGCAGGCATGGGGTCCAGG + Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1005775975 6:29130883-29130905 CCTTGGCAGGTATGGGATCCAGG + Intergenic
1006463688 6:34178466-34178488 CTTTGGCAGGCATGGGATCCAGG - Intergenic
1006634628 6:35452814-35452836 CCTTAGCAGGTATGGGAGGCGGG + Intronic
1006642957 6:35497775-35497797 CCTGGGCAGGAGTGGGACGGGGG + Intergenic
1006839795 6:37021500-37021522 GCTTGGAAGGCCTGGGGTGCAGG - Exonic
1009241589 6:61192660-61192682 CCTTTGCAGGTGTGGGATCCAGG - Intergenic
1009243238 6:61204195-61204217 CCTTGGCAGGCATGGAGTCCAGG - Intergenic
1009534190 6:64860334-64860356 CCTTGGCAGGCATGGGATCTAGG - Intronic
1009582662 6:65557256-65557278 CCTTGGCAGGTGTGGGATCTGGG - Intronic
1009600014 6:65786979-65787001 CCTTAGCAGGCGTGGGATCCAGG + Intergenic
1009684447 6:66937471-66937493 CCCTGGCAGGCATGGGATCCAGG + Intergenic
1009846770 6:69145171-69145193 GCTTGGCAGGCATGGGATCCAGG - Intronic
1009870728 6:69450013-69450035 CCTTGGCAGGCATAGGATCTGGG - Intergenic
1010519838 6:76818739-76818761 CCTTGGCAGGTATGGGATGTGGG + Intergenic
1010534712 6:77012328-77012350 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1010847024 6:80721036-80721058 CCTTGGCAGGTGTGAGATCTGGG + Intergenic
1011117146 6:83906047-83906069 CCATGGCAGGCATGGTAGGCAGG + Intronic
1011284034 6:85705378-85705400 CCTTGGCAGGTGTGGGATCCGGG - Intergenic
1011530005 6:88311687-88311709 CCTTGGCAGGCATGCGATCTAGG - Intergenic
1011930023 6:92700565-92700587 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
1012101022 6:95085123-95085145 CCTTGGCGGGCGTGGGATCCGGG + Intergenic
1012717940 6:102701161-102701183 CCTTGGCAGGTGAGGGATCTGGG - Intergenic
1013438460 6:110138048-110138070 CCTTGGCAGGTGTGGGATCCAGG - Intronic
1014357560 6:120432065-120432087 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1014392070 6:120874688-120874710 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1014418615 6:121214375-121214397 CCTGGGCAGGCATGGGATCTGGG - Intronic
1014505162 6:122246979-122247001 CCTTGGCAAGTGTGGGATCTGGG - Intergenic
1014662687 6:124193261-124193283 CCTTGGCAGGCATGAGATCCCGG - Intronic
1014968851 6:127790717-127790739 CCTTGGCAGGCATGGGATCCAGG - Intronic
1015143459 6:129959731-129959753 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1015434852 6:133173475-133173497 CCTTGGCAGGGTTGGGATCCAGG + Intergenic
1015663863 6:135604715-135604737 CCTTGGCAGATGTGGGATCCAGG + Intergenic
1016076634 6:139804302-139804324 CCTTGGCAAGCATGGGATCCCGG - Intergenic
1016109646 6:140206428-140206450 CCTCGCCAGGCATGCGATGCGGG - Intergenic
1016163163 6:140907337-140907359 CCTTGGCAGGCATGGGATTTGGG - Intergenic
1016210955 6:141532397-141532419 CCTTGGCAGGCATGGGAAACAGG + Intergenic
1016237991 6:141890989-141891011 CCTTGGCAGGCATAGGATGCAGG + Intergenic
1017396105 6:154002080-154002102 TCTTGGCAGGCATGGGATCCGGG - Intergenic
1017522211 6:155212739-155212761 TCTTGGCAGGCATGGGATGCAGG - Intronic
1017588061 6:155948119-155948141 CCTTGGTAGGCGTGGGATCTGGG + Intergenic
1018659841 6:166076096-166076118 CCTTGGCAGGTGTGGGACCCAGG - Intergenic
1019191382 6:170253030-170253052 CCCTGGCAGCCGTGGGTTGGGGG + Intergenic
1020649393 7:10855836-10855858 CCCTTGGAGGCGTGGGATCCAGG + Intergenic
1020763769 7:12296494-12296516 CCATGGCAGGTGTGGGATCTGGG + Intergenic
1021342989 7:19488186-19488208 CCTTGGCAGTCATGGGATCCAGG - Intergenic
1021430997 7:20559402-20559424 CTTTAGCAGGCATGGGATCCGGG - Intergenic
1021500640 7:21329243-21329265 CCTTGGCAAGTCTGGGATCCAGG - Intergenic
1021677809 7:23098270-23098292 TGTTGGCAGGTGTGGGATCCGGG + Intergenic
1022216792 7:28270787-28270809 CCTTGGCAGGCGTGGGATCCAGG + Intergenic
1022392021 7:29951348-29951370 GCTTGGAAGGCATGGGATCCAGG + Intronic
1023529135 7:41135641-41135663 CCTTGGCAGGTGTGGGATCTGGG - Intergenic
1023699543 7:42878640-42878662 CCTTGGCAGTCATGGGATCCAGG + Intergenic
1023699900 7:42882705-42882727 TTTTGGCAGGCATGGGATCCAGG - Intergenic
1024024769 7:45400836-45400858 CCTTGGCAGGTGTGCGATCCAGG + Intergenic
1024856912 7:53793695-53793717 CCTTGGCAGGTGTGGGATCCGGG - Intergenic
1026153407 7:67807473-67807495 CCTTGGCAGAGCTGGGTTGCAGG + Intergenic
1026370043 7:69690458-69690480 ACTTGGCAGGCATGGGATTCAGG - Intronic
1026391793 7:69910357-69910379 CCTTGGCAGGTGTGGGATCTGGG - Intronic
1027047995 7:75003869-75003891 CCTTGGCACGGGTGGGCTTCGGG - Intronic
1027575319 7:79923196-79923218 CCTTGGCAGATGTAGGATCCAGG + Intergenic
1027681825 7:81232232-81232254 CCTTGGCAGGTGTGGGATCTGGG - Intergenic
1027734776 7:81919654-81919676 CCTTGGCAGGTGTGGGACCTGGG - Intergenic
1027779708 7:82506834-82506856 CCCTTGGAGGCGTGGGATCCAGG - Intergenic
1027911945 7:84261736-84261758 CCTTGGCAGGCATGGCATCCAGG + Intronic
1027924963 7:84448105-84448127 CCTTGGCAGGTGTGGGTTCTGGG + Intronic
1028024725 7:85822205-85822227 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1028052965 7:86207895-86207917 CCTTGGCATGCATGGGATCCAGG - Intergenic
1028111903 7:86950703-86950725 CCTTGGCCAGCGTGGGACCCAGG + Intronic
1028136900 7:87231431-87231453 CTTTGGCAGTTGTGGGATGTGGG + Intergenic
1028527277 7:91800522-91800544 CCTTGGCAGGCATGGGATCCAGG - Intronic
1028596174 7:92547757-92547779 CCTTGGCAGGCATGGGATTCAGG + Intergenic
1028640917 7:93040617-93040639 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1028816741 7:95156080-95156102 CCTTGGCAGGTATGGGATCCAGG - Intronic
1029327767 7:99824338-99824360 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1029899458 7:104023337-104023359 CCTTGGCAGGTGTGGGACCCAGG + Intergenic
1029973638 7:104813546-104813568 CCTTAGCAGGCATGGGACCCAGG - Intronic
1030484358 7:110148169-110148191 CCTTGGCAGGTATGGAATCCAGG - Intergenic
1030513927 7:110518576-110518598 CCTTGACAGGCATGGGATCCAGG - Intergenic
1030722078 7:112882229-112882251 CCTTGGCAGGCATGGGATCTGGG + Intronic
1030756470 7:113292418-113292440 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1031265424 7:119573685-119573707 CCCTTGCAGGCATGGGATCCAGG + Intergenic
1031836900 7:126690250-126690272 CCTTGGCATGCGTGGGAACCAGG - Intronic
1032658199 7:133954740-133954762 CCTTGACAGGCATGGGATCCAGG - Intronic
1032858485 7:135857224-135857246 CCTTGGCAGGTGCAGGATCCAGG - Intergenic
1032919146 7:136526715-136526737 CCTTGGCAGGTGTGGGATTCAGG - Intergenic
1034101667 7:148456475-148456497 CCTTGGCAGGCGTGGGATCTGGG - Intergenic
1034198758 7:149267370-149267392 CCTGGGCAGGAGTGGGTGGCTGG + Intronic
1034210273 7:149357362-149357384 CCTTGGCAAGTGTGGGATTCAGG - Intergenic
1034215004 7:149398522-149398544 CCTGGGCAGGAGGGTGATGCTGG - Intergenic
1035242982 7:157544231-157544253 CCTTGGGAGAAGTGGGCTGCGGG + Intronic
1035252251 7:157605126-157605148 CCTTGGCAGGCATGGGACCCAGG - Intronic
1035418242 7:158706932-158706954 CCTTGGCAGGCGTGGGATCTGGG - Intergenic
1035904972 8:3499770-3499792 CCTTGGCTGTGGTGGGATGATGG + Intronic
1036778566 8:11630181-11630203 CCATGGCAGGGGTGGGAGGGTGG - Intergenic
1037150379 8:15627847-15627869 CGTTGGCAGGCATGGGATCCTGG + Intronic
1037777732 8:21846875-21846897 TCTTGGCAGGTGTGGGATCCAGG - Intergenic
1037992610 8:23331378-23331400 CCTTGGCAGGGGTGAGTTCCAGG - Intronic
1039210982 8:35214778-35214800 CCTTGGCAGGCGTGGGATTCAGG - Intergenic
1039407409 8:37325364-37325386 CCTTGGCAGGTGGGGGATGCTGG - Intergenic
1040725516 8:50378072-50378094 CCCTGGCAGGCATGAGATCCAGG - Intronic
1041205365 8:55494063-55494085 CCTTGGCAGGCGTGGGATCTAGG - Intronic
1041222402 8:55665024-55665046 CCTTGGCAGGCGTGAGATCCAGG - Intergenic
1041357128 8:57013369-57013391 CCTTGGCAGGTGTGGGACCCAGG - Intergenic
1041956505 8:63562063-63562085 CTTTGGCAGGTGTGGGATCCAGG + Intergenic
1041965360 8:63669465-63669487 ACTTGGCAGTTGTGGGATACAGG - Intergenic
1042005048 8:64170173-64170195 CCTTGGCAAGTGTGGGATCCAGG + Intergenic
1042196694 8:66237396-66237418 GTTTGACAGGCGTGGGATCCAGG - Intergenic
1042325424 8:67522819-67522841 AGTGGGCAGGCGTGGGATCCAGG + Intronic
1042336910 8:67639353-67639375 CCTTGGCAGGCATGGGATCCAGG - Intronic
1042439546 8:68810169-68810191 CCTTGGCAGGCATGGGATCTGGG - Intronic
1042625246 8:70749650-70749672 CCTTGGCAGGCATGGGATCCAGG + Intronic
1043082409 8:75783739-75783761 CCTTGGCAGGTGTGAGATTCAGG - Intergenic
1043180447 8:77082079-77082101 CCTTGGCAGGCATGGGATCCAGG - Intergenic
1043414368 8:80032937-80032959 CCTTGGCAGGTGTGGGATCTGGG - Intronic
1043695385 8:83209707-83209729 CCTTGGCAGGTATGGGATCTGGG + Intergenic
1043702723 8:83312063-83312085 CCTTGGCAGGCATGGGATCTAGG - Intergenic
1043756039 8:84005421-84005443 CCTTGTCAGGCATGGGCTGTGGG - Intergenic
1044051530 8:87511855-87511877 TCTTGGGAGCCTTGGGATGCAGG - Intronic
1044149072 8:88751747-88751769 CGTTGGCAGGCGTGAGATCTAGG - Intergenic
1044614017 8:94120752-94120774 TCTTGGCAGGTGTGGGATCTGGG + Intergenic
1044774821 8:95677417-95677439 CCTGGGCAGGCATGGGATCCAGG - Intergenic
1045300592 8:100907376-100907398 CCCTGGCAGGTGTGGGATCCGGG - Intergenic
1045456228 8:102382146-102382168 CCGTGGCAGGTGTGGCATGATGG - Intronic
1045782778 8:105886931-105886953 CCTTGGCAGGCGTGAGATTCGGG + Intergenic
1045888170 8:107123772-107123794 CCTTGGCAGGCGTGGGAACTGGG + Intergenic
1046249496 8:111611743-111611765 CCTCGGCAGGTGTGGGATTCAGG - Intergenic
1046503618 8:115110719-115110741 CCTTGGCAGGCATGGGACTCAGG - Intergenic
1046674515 8:117093825-117093847 CCTTGGCAGGCATGGGATTCAGG - Intronic
1047104553 8:121719186-121719208 CCTTGGCACGCATGGGATCCAGG - Intergenic
1047543776 8:125796504-125796526 CCTTGGCAGGCATGGGATCCAGG - Intergenic
1048253668 8:132888189-132888211 GCTTGGCAGGCGTCAGATCCTGG - Exonic
1048692915 8:136988689-136988711 CCTTGGCAGGTGTGGGATCCGGG - Intergenic
1049140612 8:140950550-140950572 CCTTGGCAGGTGTGGGATCCAGG + Intronic
1049367403 8:142247113-142247135 CCTGGGCAGGTGTGGGAAGCAGG + Intronic
1049394265 8:142391822-142391844 CCTTGGCATGTGTGGGATCTGGG + Intronic
1049433950 8:142577662-142577684 GCTTGGGAGGCGTGGGCTCCGGG + Intergenic
1049622219 8:143603678-143603700 CCTGGGCAGGCCTGGGAGCCTGG - Intergenic
1049709744 8:144058147-144058169 GCCTGGCAGGGGTGGGGTGCTGG + Exonic
1049826703 8:144673765-144673787 ACTTGGCAGGTGTGGGATCTGGG - Intergenic
1050071131 9:1815504-1815526 ACTGGGCAGGGGTGGGATGGTGG + Intergenic
1050130622 9:2407691-2407713 CCGTGGTAGGCGTGGGATCCAGG + Intergenic
1050589518 9:7147966-7147988 CCTTGGCAGGCACGGGATCCGGG - Intergenic
1050888266 9:10791544-10791566 CCTTGGCAGGCATGGGATACTGG + Intergenic
1050928478 9:11296496-11296518 CCTGAGCAGGAGTGGAATGCTGG + Intergenic
1051029541 9:12658103-12658125 CCTTGGAAAGCATGGGATCCAGG - Intergenic
1051865069 9:21670967-21670989 CCTTTGCAGGCTTGGCATGATGG + Intergenic
1052116122 9:24649916-24649938 CCTTGGCAAATGTGGGATTCAGG + Intergenic
1052437304 9:28444854-28444876 CCTTAGCAGGTGTGGGATCCAGG + Intronic
1052597303 9:30575911-30575933 CCTTGGCAGGCGTGGGATCTGGG + Intergenic
1052609723 9:30757899-30757921 CCTTGGCAGGTGTGGGATATGGG - Intergenic
1052691581 9:31821804-31821826 TTTTGGCAGGCATGGGATCCCGG + Intergenic
1053128348 9:35600510-35600532 CCTTGGCAGGCATGGGACCCAGG + Intergenic
1053445182 9:38147108-38147130 CCTTGGCAGGCGTGGGATCCAGG + Intergenic
1053877207 9:42557240-42557262 CCTTGGCAGACATGCGATCCAGG - Intergenic
1053895464 9:42737453-42737475 CCTTGGCAGACATGCGATCCAGG + Intergenic
1054234487 9:62544482-62544504 CCTTGGCAGACATGCGATCCAGG + Intergenic
1055572725 9:77632851-77632873 CCTTGGCAGGTGTGGGACTCAGG + Intronic
1055645580 9:78358508-78358530 CTTTGGCAGGCATGGGATCCAGG + Intergenic
1055816665 9:80213873-80213895 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1056756640 9:89385868-89385890 CCTTGGCAGGGGTGGGTGGGCGG - Intronic
1057468698 9:95338585-95338607 CCTTGGCAGGCATGGCATCCAGG + Intergenic
1058077824 9:100668300-100668322 CCTTGGCAGGTGTGGGATCCGGG + Intergenic
1058270510 9:102967125-102967147 CCTTGGTAGGTGTGGGATCCAGG - Intergenic
1058280275 9:103104392-103104414 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1058487545 9:105457718-105457740 CCTCGGCAGGTGTGGGATCCAGG - Intronic
1058545628 9:106058567-106058589 CCTTGGCAGGTGTGGGATCCAGG - Intergenic
1059104954 9:111502696-111502718 CCTTGGCAGGTGTGGGATCTGGG + Intergenic
1059326209 9:113505350-113505372 TCTTGGCAGGGGTGGGCTGTGGG + Intronic
1059421524 9:114195427-114195449 CCTAGGCAGGGGTGGCTTGCTGG + Intronic
1059681659 9:116591434-116591456 CCTTGGCAGGCATGGGATCCAGG + Intronic
1059853014 9:118364460-118364482 CCTTGACAGGCATGGGATCTGGG + Intergenic
1060758685 9:126230622-126230644 CCTTGGCAGGCCTGTGTGGCTGG - Intergenic
1060933513 9:127503328-127503350 CCTGGGAAGGCGTGTGGTGCAGG + Exonic
1061267474 9:129515159-129515181 CCTTGGCAGACATGAGATCCAGG + Intergenic
1061678993 9:132233386-132233408 CCAGGGCAGCCGTGGGAGGCTGG + Intronic
1061825923 9:133258164-133258186 GCATGGAAAGCGTGGGATGCAGG + Intronic
1061874481 9:133537006-133537028 ACTTGGCAGGCGAGGGCTGAGGG + Intronic
1061945219 9:133904946-133904968 CCCTGGCAGGGAGGGGATGCAGG + Intronic
1062537240 9:137026457-137026479 CCTTGCCAGGCTTGTGATGTGGG - Intronic
1062544411 9:137055111-137055133 CCCTGGCCGGGCTGGGATGCGGG - Intergenic
1185936099 X:4258241-4258263 CCTTTGCAGGTGTGGGATCCAGG + Intergenic
1186805987 X:13140295-13140317 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1187871075 X:23766042-23766064 CCTCGGCAGGCGTGGAATCCTGG - Intronic
1188195073 X:27222921-27222943 CCTTGGCAGATGTGGGTTCCAGG + Intergenic
1188207916 X:27381679-27381701 CCTTGGCAGGCATGGGATCCAGG + Intergenic
1188648005 X:32593052-32593074 CCTTGGCAGGCATGGGGATCCGG + Intronic
1188727616 X:33606142-33606164 CCTTGGCAGGCATGGGATACAGG - Intergenic
1188756659 X:33970317-33970339 CCTTGTCAGGCATGGGATCCAGG + Intergenic
1188961683 X:36500766-36500788 CTTTAGCAGGCATGGAATGCAGG - Intergenic
1189024017 X:37371837-37371859 CCTTGGCAGGCTTGGGAGCCAGG + Intronic
1189083723 X:37998622-37998644 CCTTGACAGGTGTGGGACCCAGG + Intronic
1190360435 X:49644174-49644196 CCTTGGCAGGTGTGGGGTCCAGG - Intergenic
1191722728 X:64248254-64248276 CATTGGCTGGGGTGGGATGCTGG + Intergenic
1192267339 X:69547752-69547774 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1193211330 X:78810446-78810468 CCTTGGCAGGCATGGGATCCAGG - Intergenic
1193417563 X:81242000-81242022 CCTTGGCAGGTATGGGATCCAGG + Intronic
1193554300 X:82933548-82933570 CATTGGCAGGTGTGGGATGAAGG + Intergenic
1194212336 X:91083438-91083460 CCTTGGCAGATGTGGGATTCAGG + Intergenic
1194316261 X:92380330-92380352 CTTTGGCAGGCATGGGATCCGGG + Intronic
1195127642 X:101823486-101823508 CCTTGTCAGATATGGGATGCAGG + Intergenic
1195178404 X:102333296-102333318 CCATGGCAGGCGTGTGATCCAGG - Intergenic
1195180460 X:102353787-102353809 CCATGGCAGGCGTGTGATCCAGG + Intergenic
1195655163 X:107325720-107325742 CCTTGGCAGGCATGGGGCCCAGG + Intergenic
1195880177 X:109585613-109585635 CCTTGACAGGTGTGGGATCCAGG - Intergenic
1197035817 X:121871366-121871388 CCTTGGCAGGCATGGGATCCGGG + Intergenic
1197342348 X:125288569-125288591 CCTTGGCAGGTGAGGGATCCAGG + Intergenic
1197527361 X:127578641-127578663 CCTTGGCAGGTGTGGGATCCAGG + Intergenic
1197609416 X:128622398-128622420 CCTTGGCAGGCATGGGATCCAGG - Intergenic
1198189606 X:134288853-134288875 CCTTGGCAAGCACGGGATCCGGG + Intergenic
1199187864 X:144938551-144938573 CCTTGGAAGATGTGGGATCCAGG - Intergenic
1199359884 X:146906278-146906300 CCTTGGCAGGAGTGGGATCCAGG - Intergenic
1199785618 X:151102447-151102469 CATTGCCAGGGGTGGCATGCAGG + Intergenic
1200392284 X:155956294-155956316 CCTTGGCAGGCATGGGCTCCAGG - Intergenic
1200411639 Y:2867646-2867668 CCTTGGCAGGCATGGGATCCAGG - Intronic
1200424753 Y:3008723-3008745 CCTTGGCAGACATGGAATCCAGG - Intergenic
1200624305 Y:5491903-5491925 CTTTGGCAGGCATGGGTTCCGGG + Intronic
1200749047 Y:6928489-6928511 CCTTGGCAGGCATGGGATCCAGG - Intronic
1201720425 Y:17090303-17090325 CCTTGGCAGGTGTCGGATCCAGG + Intergenic
1202032215 Y:20589237-20589259 ACTTGGCAGGCGTAGAATGCAGG - Intronic