ID: 1095145770

View in Genome Browser
Species Human (GRCh38)
Location 12:38724097-38724119
Sequence TACTTCCCATTTTAGATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095145768_1095145770 10 Left 1095145768 12:38724064-38724086 CCAGCATGAAAATTATCTACAAG 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1095145770 12:38724097-38724119 TACTTCCCATTTTAGATAAAAGG 0: 1
1: 0
2: 2
3: 42
4: 407
1095145767_1095145770 20 Left 1095145767 12:38724054-38724076 CCTTTGAAGACCAGCATGAAAAT 0: 1
1: 0
2: 1
3: 20
4: 234
Right 1095145770 12:38724097-38724119 TACTTCCCATTTTAGATAAAAGG 0: 1
1: 0
2: 2
3: 42
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095145770 Original CRISPR TACTTCCCATTTTAGATAAA AGG Intronic
901115155 1:6837518-6837540 TGCTTCCCATTTCTGAGAAAGGG + Intronic
901278610 1:8013436-8013458 TTCTTCCCATTTTCAATAATGGG + Exonic
903632249 1:24784306-24784328 TTATTCCCATTTTATAGAAAAGG + Intronic
903997541 1:27316989-27317011 TATTTCTCATTTTAGAGAGAAGG + Intergenic
905650419 1:39652806-39652828 TACTTCCCAATTAAGGTCAATGG + Intergenic
905853342 1:41290481-41290503 TTGTTCCCATTTTACAGAAAAGG - Intergenic
905918489 1:41702482-41702504 CAGTTCCCATTTTACATACAGGG - Intronic
906854507 1:49290349-49290371 TTCTTCTCATTTTAGATGACAGG + Intronic
906856134 1:49307149-49307171 AACTTTCCATTTTACAAAAAAGG - Intronic
907049104 1:51317835-51317857 TACTTCCCACGTGAGATAACAGG + Intronic
907658839 1:56373024-56373046 TTCTTCCCATTTTAGAACAAAGG - Intergenic
908166832 1:61467292-61467314 TTATTCCCATTTTACATATAGGG + Intergenic
908166899 1:61467863-61467885 TTATTCCCATTTTACATATAGGG - Intergenic
908218448 1:61979318-61979340 TCCTTCCCATCTTAGGTTAATGG + Intronic
909596882 1:77415912-77415934 CACTTCTCATTTTAGAAAAGAGG - Intronic
910006416 1:82402735-82402757 AACTCTCCATTCTAGATAAATGG - Intergenic
910070915 1:83212668-83212690 TCCTTCCCACTTTAGACAAAGGG + Intergenic
910334183 1:86109480-86109502 TTCTCCCCATTTTACAGAAAAGG + Intronic
910414010 1:86978786-86978808 TATTTCTCCTTTTAGACAAAAGG - Intronic
911251270 1:95579259-95579281 TATTTCCAAGTTTAGATAAAAGG + Intergenic
911416046 1:97575768-97575790 TTCTCCCCATTTTATATATAAGG - Intronic
912271475 1:108214275-108214297 CAATGCCCATTTTAGAAAAAAGG - Intergenic
914425712 1:147573668-147573690 TGCTCCCCATTTTAGAGATAAGG - Intronic
915833957 1:159158699-159158721 TTTTTCCCATTTTACACAAAAGG + Intergenic
916256179 1:162790340-162790362 CAGTGCCCATTTTAGAGAAAAGG - Intergenic
916300738 1:163271161-163271183 TACTGGCCATTTTATAAAAATGG + Intronic
916372147 1:164110080-164110102 AACTTCTCATTTTTTATAAAAGG - Intergenic
917030718 1:170687563-170687585 TAATCCTCATTTTAGAGAAAAGG - Intronic
917078435 1:171230918-171230940 TTCTTTCCATTTTAGATAATTGG - Intergenic
917254751 1:173102601-173102623 TTCTGGACATTTTAGATAAATGG + Intergenic
917427605 1:174931207-174931229 TATTTCCCATTTTATTTAAAAGG + Intronic
917991663 1:180386460-180386482 AACTTCCCAAATTTGATAAAAGG - Intronic
918794909 1:188881872-188881894 TTCTTCTCATTTTAGATCATGGG - Intergenic
919346055 1:196379826-196379848 TAATTCACATTTTAGAGATAAGG - Intronic
919646264 1:200097826-200097848 TTCTTCCTATTCTAGATTAAAGG - Intronic
922509042 1:226147547-226147569 TCCTCCCCATTTTAGAAAGATGG + Intronic
924025594 1:239829781-239829803 TTATTCCCATTTTAGAGATAGGG - Intronic
1063992779 10:11584271-11584293 AACATCACATTTAAGATAAAAGG + Intronic
1064055881 10:12096860-12096882 TCCATACCTTTTTAGATAAAGGG + Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1065223292 10:23518089-23518111 TCCTTCCCATTTTAGGGAAGGGG + Intergenic
1065231187 10:23600016-23600038 GATGTCCCATTTTACATAAATGG - Intergenic
1065702425 10:28438443-28438465 TACTTCACATTCTAAAGAAATGG - Intergenic
1066406007 10:35119086-35119108 TCCATCCAATGTTAGATAAAAGG - Intergenic
1067468284 10:46517565-46517587 CTATTTCCATTTTAGATAAATGG - Intergenic
1068627035 10:59260554-59260576 TAGTTTCTACTTTAGATAAAGGG - Intronic
1068628629 10:59276501-59276523 TTTTTCCCATTTTAAACAAAAGG + Intronic
1068830340 10:61486963-61486985 TACTTCTCCCTTTAGTTAAATGG - Intergenic
1069834260 10:71298893-71298915 TTGTTCCCATTTTAGAGACAAGG + Intronic
1069952335 10:72027705-72027727 TTCCTCCCATTTGAGATAAGGGG - Intergenic
1070261950 10:74865070-74865092 TCCTTCCCATTTTACAGATAAGG - Intronic
1070503048 10:77089483-77089505 TAATCCTCTTTTTAGATAAAAGG - Intronic
1071053715 10:81483337-81483359 TATTTCCCATTATAGGTAAAAGG - Intergenic
1071100717 10:82034529-82034551 TTATTCTCATTTTAGATATAAGG - Intronic
1072734339 10:97868969-97868991 TATTTCCCATTTTACATATGGGG + Exonic
1072756022 10:98021540-98021562 TATTTCCCATTTTACAGAACGGG - Intronic
1073591862 10:104765429-104765451 TACCTCCCATTTTACAGATAAGG - Intronic
1074512484 10:114128593-114128615 TAATTCCCATTTTACAGATAAGG - Intronic
1075463847 10:122636821-122636843 TACTTTACTTTATAGATAAATGG + Intronic
1075630511 10:123998028-123998050 AACTTCCCATTTTACAGAAAAGG - Intergenic
1076115276 10:127891279-127891301 GATTTCCAATTTGAGATAAATGG - Intronic
1077458751 11:2698338-2698360 TACTCTCAATTTTATATAAAAGG + Intronic
1078609579 11:12808838-12808860 TTCTCCCCATTTTACAGAAAAGG - Intronic
1079651454 11:22934973-22934995 CACTTCCCCATTTAGATATATGG - Intergenic
1079713927 11:23720356-23720378 TAATTCTCATTTTACATATAGGG - Intergenic
1080070066 11:28072074-28072096 TACTTGCCATTTTAGAGCAATGG - Intronic
1081249154 11:40808047-40808069 TTCTTCCCATTTTACAAATAAGG - Intronic
1082192497 11:49264004-49264026 TTCTTCACATGTTATATAAATGG + Intergenic
1082662366 11:55927497-55927519 TAATTCCTGCTTTAGATAAAAGG - Intergenic
1082874631 11:57975421-57975443 CACTTCCTTTTTTAGAAAAAGGG + Intergenic
1083134808 11:60662233-60662255 TATTTCATATTTCAGATAAAGGG + Intergenic
1084558538 11:69889653-69889675 TAATTCCCATTTTACAGAGAAGG - Intergenic
1085548018 11:77338846-77338868 TACTGGGCATTTTATATAAATGG - Intronic
1085565991 11:77513962-77513984 TAATTCTCATTTCATATAAATGG - Intergenic
1086510293 11:87549950-87549972 TACTTAACATTTTAAAAAAAAGG - Intergenic
1086673622 11:89576963-89576985 TTCTTCACATGTTATATAAATGG - Intergenic
1087457196 11:98402226-98402248 TATATTCCATTTTACATAAAAGG + Intergenic
1087961603 11:104357254-104357276 TACTTTGAATTTCAGATAAAGGG - Intergenic
1087981593 11:104620643-104620665 TTATTCCCATTTTAGATGTAGGG - Intergenic
1088333094 11:108673564-108673586 TTCTTGGCATTTTTGATAAATGG + Intronic
1088561625 11:111121460-111121482 TACTTTACATTTTACATAAAAGG + Intergenic
1090529231 11:127573625-127573647 TTCTTAACATTTCAGATAAAAGG - Intergenic
1091829569 12:3540115-3540137 TTATTCCCATTTTAGAGAAAAGG + Intronic
1092386011 12:8036288-8036310 TTCTTCCCATTTTATCTGAAAGG - Intronic
1092456495 12:8648404-8648426 TAATTCTCATTTTACAGAAAGGG - Intronic
1092821835 12:12359924-12359946 TATTTCTCATTTTAGAAATAGGG + Intronic
1093587924 12:20864105-20864127 TTTTTCCAATTTTAAATAAAGGG - Intronic
1093601118 12:21024498-21024520 TTTTTCCAATTTTAAATAAAGGG - Intronic
1094186249 12:27646047-27646069 TACTTCCTTTTTCAGACAAATGG + Exonic
1094324476 12:29221785-29221807 TATTTCCCATTAAAAATAAAAGG - Intronic
1094756014 12:33469176-33469198 TACTTCTTATTTTAAATAAGTGG + Intergenic
1094799843 12:34020849-34020871 AACTTTCCATTTTATGTAAAGGG + Intergenic
1095145770 12:38724097-38724119 TACTTCCCATTTTAGATAAAAGG + Intronic
1096997921 12:55850863-55850885 TCCTCCCCATTTCAGTTAAAAGG - Intergenic
1097325154 12:58268123-58268145 TACCTTCCATTTTAGAGAACTGG - Intergenic
1097968895 12:65611045-65611067 TATTTTCCTTTTTGGATAAAAGG + Intergenic
1098127806 12:67318385-67318407 TAATTCCCATTTTATAGATAGGG - Exonic
1098148570 12:67522878-67522900 TACTATGCATTTTATATAAAGGG + Intergenic
1098263358 12:68694000-68694022 TTATTCCCATTTTAGAGAAAAGG + Intronic
1098482073 12:70974990-70975012 AACTTTCCATTTTGGATATATGG + Intergenic
1098798221 12:74921134-74921156 TACTCCTCATTTTTGACAAATGG - Intergenic
1099022299 12:77421778-77421800 AACTTTAGATTTTAGATAAATGG + Intergenic
1099674412 12:85739925-85739947 TACTTCTCATTTTTCATCAAGGG - Intergenic
1099959451 12:89382571-89382593 AACTTCCTATTTTAGACAGATGG + Intergenic
1100120703 12:91366216-91366238 TACTTCCCATTTTATTTGTAGGG - Intergenic
1100842455 12:98627393-98627415 TACTTACCATTAGAGTTAAAAGG - Intronic
1101041501 12:100760517-100760539 TACTCCTCATTTTAGAGAACAGG - Intronic
1101415680 12:104506359-104506381 TTGTTCCCATTTTAGATATGAGG - Intronic
1102869734 12:116404545-116404567 CACTTGACATTTTACATAAATGG + Intergenic
1103410464 12:120708019-120708041 TACTTTTTATTTTAAATAAATGG + Intergenic
1107043315 13:35971354-35971376 TAGTTCCCATTTTAGGTTGAAGG + Intronic
1107150657 13:37106987-37107009 TACTTCTCATTTTATACAAGTGG + Intergenic
1107798625 13:44081915-44081937 TAGTTCCCATTTTAAAAAAAAGG - Intergenic
1108074891 13:46669746-46669768 TCTTTCCCAATTTAGAAAAAGGG - Intronic
1108081737 13:46744309-46744331 CCCTTCCAATGTTAGATAAAAGG + Intronic
1108818722 13:54320279-54320301 TATTTCCATTATTAGATAAAGGG + Intergenic
1109532110 13:63663602-63663624 TTCTGACCATTTTATATAAATGG + Intergenic
1109777361 13:67059129-67059151 TGCTTGCTGTTTTAGATAAAGGG - Intronic
1110979644 13:81879972-81879994 AACTTTCCATTTTACAGAAAAGG + Intergenic
1111032684 13:82625818-82625840 TATTATCCACTTTAGATAAAAGG - Intergenic
1111805479 13:93035170-93035192 TCATTCCCATTTTAGAGAAATGG - Intergenic
1112211772 13:97384924-97384946 TACTCCCCATTATAGATAAAGGG - Intronic
1113541455 13:111112972-111112994 TACTACCCACTCTAGGTAAATGG + Intergenic
1114674500 14:24431329-24431351 TTATTCCCATTTTAGAGATAAGG - Intronic
1115219093 14:31041489-31041511 TACTTCCCATTTCTAATAAATGG - Intronic
1115463471 14:33687653-33687675 TACTTCCCATTTCACAGAACGGG + Intronic
1115730445 14:36263027-36263049 TAATTCCCATTTTACAGATAGGG - Intergenic
1116123312 14:40749387-40749409 TAATTGTCATTTTAGAAAAATGG + Intergenic
1116536321 14:46035690-46035712 TACTACACATTTTATACAAATGG - Intergenic
1116693154 14:48136353-48136375 AAATTCCCATTTTACAAAAAGGG - Intergenic
1117070377 14:52050571-52050593 TCCTTCCCATTTTACAGAGATGG - Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117914499 14:60662900-60662922 TCCTTCCCAATTTATTTAAAAGG + Intergenic
1118678173 14:68211263-68211285 TACTTCCACTTTTAGTTCAAGGG + Intronic
1118771884 14:68947772-68947794 TACTTCCCTTTTTAGATGATAGG - Intronic
1118996324 14:70839974-70839996 TACTTGCCACTTTAGATCAGGGG + Intergenic
1120016205 14:79476556-79476578 TACCTGCCATTTTACAGAAATGG - Intronic
1120324297 14:83005845-83005867 TGCTTCACATTTTAAAAAAATGG - Intergenic
1120918419 14:89730875-89730897 TACTTCCCAGTTTAATTTAAGGG - Intergenic
1122181842 14:99960839-99960861 TTCTTGACATTTTATATAAATGG + Intergenic
1124934028 15:34152586-34152608 TTCATCCCATCTTAGAGAAATGG + Intronic
1126292531 15:47098857-47098879 AACTTCCCATTTGAAATGAAAGG - Intergenic
1126591030 15:50339897-50339919 TACTTCCCAATTTAGAAATCTGG + Intronic
1126860285 15:52876461-52876483 ACCTTCCCATTTTACATAACAGG - Intergenic
1127342536 15:58063006-58063028 TATTTCACATTTTTAATAAAGGG - Intronic
1127594663 15:60467422-60467444 TTTTTCCCATTTTAAATTAAAGG + Intronic
1127820367 15:62649482-62649504 TACTTCCTATGTCAGATTAAGGG + Intronic
1128397692 15:67245402-67245424 TTCTACACATTTTATATAAATGG - Intronic
1128485884 15:68088197-68088219 TATATCCCATTTTAAATTAAAGG + Intronic
1128795946 15:70466699-70466721 TGATTCCCATTTTAGAGACAGGG + Intergenic
1129363285 15:75037966-75037988 TCCTTCACCTTTTTGATAAATGG - Intronic
1129517888 15:76167920-76167942 TGATTCCCATTTTACAGAAAGGG - Intronic
1130029653 15:80300285-80300307 TAAGTCCCTTATTAGATAAATGG + Intergenic
1130306364 15:82714538-82714560 TACTTCCCATTTTACAGATGGGG + Intergenic
1130542838 15:84834273-84834295 TAATTCCTATTTTATACAAAAGG - Intronic
1130607654 15:85332156-85332178 TACTTTCCACATTAGAGAAATGG - Intergenic
1131462556 15:92628611-92628633 TAATTTGCATTTTAGGTAAAGGG - Intronic
1131737943 15:95354192-95354214 GATTTCTCATTTGAGATAAAGGG - Intergenic
1132034064 15:98465536-98465558 TACTACCCATTTTATAGACATGG + Intronic
1132257693 15:100391767-100391789 TGATTCCCATTTCAGAGAAATGG + Intergenic
1133415182 16:5601043-5601065 TTCTTCCCATTTTGGATAGATGG + Intergenic
1133710698 16:8398264-8398286 TCCTTCCCATTTTACAGAAAGGG + Intergenic
1135285168 16:21187137-21187159 TACCTCCCATTTTAGAGATAAGG + Intergenic
1135593850 16:23726420-23726442 TACATCCAACTTTATATAAATGG - Intergenic
1135878737 16:26231204-26231226 TATTTCCTATTTTAAATACAGGG - Intergenic
1138292116 16:55856613-55856635 TTCTTCTCACTTTTGATAAAAGG + Intronic
1138489746 16:57369853-57369875 TGCATCCCATTTTACATATAGGG + Intergenic
1139060528 16:63245304-63245326 TCCTTCCCATGTTAGAGAAATGG + Intergenic
1139111250 16:63893600-63893622 TACTTCCCATTTGGGAAAGATGG - Intergenic
1141733570 16:85838128-85838150 TATTTCAAATTTTAGATACAGGG - Intergenic
1141764360 16:86048809-86048831 TTATTCCCATTTTAGAGATAGGG + Intergenic
1142655029 17:1386081-1386103 TACTACCCATTTTACAGATAAGG - Intronic
1143222638 17:5275476-5275498 TTATTCCCATTTTAGAGATAAGG + Intergenic
1145187286 17:20805862-20805884 TACTGGACATTTTATATAAATGG + Intergenic
1145736923 17:27239675-27239697 TTCTTCCCATTTTACAGACAGGG + Intergenic
1147320248 17:39641695-39641717 TTCTCCCCATTTTACAGAAAAGG + Intronic
1149155150 17:53620209-53620231 TCGTTCCAATTTTAGATAGATGG - Intergenic
1149158643 17:53665060-53665082 TTCGTGCCAATTTAGATAAAAGG + Intergenic
1149877840 17:60255813-60255835 TACTGCCCATTTTCTTTAAAAGG + Intronic
1150673261 17:67220939-67220961 TAATTCCCAGTTTAGTTTAAGGG + Intronic
1152007117 17:77689318-77689340 TGCTTCCCATTTTGCAGAAAAGG + Intergenic
1153338080 18:3945136-3945158 TCATTCCCATTTTAGAGAGAGGG - Intronic
1155658360 18:28218317-28218339 TACCTCCCATTTTATATAAGAGG - Intergenic
1156376637 18:36520746-36520768 TCCTTCTCATCTCAGATAAAAGG - Intronic
1156438867 18:37164068-37164090 TTCTTTCCATTTTAGAGAATGGG - Intronic
1156496227 18:37526962-37526984 TACTGCCCATTTTATAGATAAGG - Intronic
1156922814 18:42543371-42543393 TACTTCCCATATTAAATTCAAGG - Intergenic
1157048210 18:44128492-44128514 TCCTTCTCCTTTTACATAAAGGG + Intergenic
1157957994 18:52120457-52120479 TACATCAAATTTAAGATAAATGG - Intergenic
1158246857 18:55441887-55441909 TCATACCCATTTTAAATAAATGG + Intronic
1158823812 18:61191542-61191564 TACTTTACTTTTTAGATAGATGG - Intergenic
1159468849 18:68822996-68823018 TACTTCCCATTTGTGCTACAGGG - Intronic
1159586128 18:70285299-70285321 TTTTTCCCCTTTTAGATGAAGGG + Intergenic
1159926853 18:74277391-74277413 TACTTCCCATTTCACCTAGAAGG + Intronic
1159950891 18:74482334-74482356 TACTTCAGATTTAAAATAAAGGG - Intergenic
1163389245 19:17020346-17020368 TATTTTCATTTTTAGATAAAGGG - Exonic
1164106794 19:22114240-22114262 CACTTCCCAGTTTAGATAATTGG + Intergenic
1166135525 19:40774926-40774948 TTGTTCCCATTTTACATATAAGG + Intronic
1167758633 19:51429089-51429111 TTCTTTCCATTTTATGTAAAAGG + Intergenic
925844370 2:8021975-8021997 TACTAACCAGTTTTGATAAATGG - Intergenic
925911675 2:8577814-8577836 TCCTTCCCATTTTATACAAGGGG - Intergenic
926525921 2:13980624-13980646 CACTTCTCATTTTAGAAAAGGGG + Intergenic
927215163 2:20664339-20664361 TTCTTCCCATTCTATAGAAAAGG - Intergenic
928621257 2:33090572-33090594 TGGTTCCCATTTTAGAGATAGGG + Intronic
928646915 2:33364409-33364431 TAGTTCACATTTTAGTTAAAAGG - Intronic
929466178 2:42146292-42146314 TTCTTCCCTTTATAGATTAATGG + Intergenic
929941764 2:46339499-46339521 TCATTCCCATTTTAGAGATAAGG - Intronic
930924318 2:56798019-56798041 TTCTGACCATTTTATATAAATGG + Intergenic
931025590 2:58110670-58110692 TAATGCCCATGTAAGATAAAAGG + Intronic
931027371 2:58127095-58127117 TACTAAACATATTAGATAAATGG - Intronic
931487489 2:62707005-62707027 TAAATCCCATCTTAGATGAATGG - Exonic
932256906 2:70295358-70295380 CACTTCACATTTTATATACAGGG - Intergenic
933119362 2:78517621-78517643 CACTTCCCATTATAGTTAAGAGG - Intergenic
933196494 2:79396027-79396049 TACTTCACATATTAGAAAACAGG - Intronic
933293206 2:80460757-80460779 ACATTCCCATTCTAGATAAATGG + Intronic
935307502 2:101751570-101751592 TTCTTTCCATTTTAAATACATGG - Intronic
935545644 2:104396990-104397012 TGCTTCCCAGTTTATATAAGAGG + Intergenic
936468931 2:112780631-112780653 ACCTTCTCATTTTACATAAAAGG - Intronic
938024118 2:127930574-127930596 TACTACCAATTTTATAGAAATGG + Intergenic
938228655 2:129639050-129639072 TACTTCCCATTTTACATATAAGG - Intergenic
938228904 2:129640876-129640898 TACTTCCCATTTTACATGTAAGG + Intergenic
938684002 2:133719289-133719311 TATTTCCAATTTTACAGAAAGGG + Intergenic
939315769 2:140547639-140547661 TACTTCCTATATTACATAACAGG - Intronic
940107557 2:150116151-150116173 TACTTTCAACTTTAGATACATGG + Intergenic
940378291 2:152983342-152983364 ATTTTCCCATTTTAGGTAAAAGG - Intergenic
940545183 2:155073928-155073950 TACTTCCAAGTATGGATAAATGG + Intergenic
940672420 2:156687210-156687232 CATTTCCCATTGTAGATAAGGGG + Intergenic
940788322 2:158005666-158005688 TACTTTTCATTTTTGGTAAATGG - Intronic
941253614 2:163199321-163199343 TACTGCACAGGTTAGATAAATGG + Intergenic
942475731 2:176318048-176318070 TGCTTTCCATCTTAGAAAAATGG + Intronic
942720994 2:178952419-178952441 TTATTCCCATTTTACAGAAAAGG + Intronic
943045840 2:182861344-182861366 TTATTCCCATTTTGGAGAAAAGG - Intronic
943328481 2:186530162-186530184 TTATGCCCATTTTACATAAAAGG + Intergenic
945214573 2:207419845-207419867 TACTTGCTATTTTGGAGAAAAGG - Intergenic
945440859 2:209877939-209877961 TCCTTCCCATTTTAGGCAATTGG + Exonic
945745650 2:213717839-213717861 TACTTTCCATTTTACAAAATGGG + Intronic
945792598 2:214323853-214323875 TACTTCCAATTTTATAAGAAAGG + Intronic
945888816 2:215406694-215406716 TATTACCTATTTTAGATAAAAGG - Intronic
1169356636 20:4912473-4912495 TTATTCCCATTTTAGAGACAGGG + Intronic
1171022607 20:21600228-21600250 TAGCTCCCATTTTATATAAAAGG + Intergenic
1171277395 20:23869722-23869744 AATTTCCTATTTCAGATAAATGG + Intergenic
1172158452 20:32846795-32846817 TTCTTTCCATTTTACATAGAAGG + Intronic
1172461221 20:35120365-35120387 TAGTTCTTATTTTAGAGAAAAGG + Intronic
1172822114 20:37746053-37746075 TACTTCCCACTTCAGATCAAGGG - Intronic
1173175512 20:40762015-40762037 TTCTTCCCATTTTATATACAAGG + Intergenic
1173228708 20:41177594-41177616 TTCTTCACATTTTAATTAAATGG + Intronic
1173721383 20:45261065-45261087 TATATCCCATTTTAAAGAAAAGG + Intergenic
1173751332 20:45479074-45479096 CACTTCCCAGGTTAGATAGAGGG - Intronic
1174282380 20:49448567-49448589 TTCTTCCCATTTTAGAGATGAGG + Intronic
1174710420 20:52698570-52698592 TTTTTGCCATTTTATATAAATGG - Intergenic
1174883710 20:54308258-54308280 TTATTCCCATTTTAGAGAAGAGG - Intergenic
1175027639 20:55919358-55919380 TGGTTCTCATTTTAGATATAGGG + Intergenic
1176690826 21:9906437-9906459 TTCTTCCCATGTCAGAAAAAAGG + Intergenic
1176961327 21:15162319-15162341 TTCTTGACATTTTATATAAATGG - Intergenic
1177426869 21:20934570-20934592 TACTCCCCCTTTCAGTTAAAGGG - Intergenic
1177710452 21:24767168-24767190 AACTTCCTATTTTGGTTAAAAGG - Intergenic
1178706429 21:34877360-34877382 TAATTCACATTTTAGCCAAATGG - Intronic
1179013988 21:37578997-37579019 TACTTCCCAGTTTATATGCATGG + Intergenic
1179061486 21:37983332-37983354 TATTTATCATTTTAGATAGAGGG + Intronic
1180211132 21:46295979-46296001 TGCTTTCCATTTTAGATGGAAGG + Intronic
1181506711 22:23363349-23363371 TTCTTCTCACTTTTGATAAAAGG + Intergenic
1182676745 22:32044904-32044926 TGCTGCCCATTTTACTTAAAAGG - Intronic
1182729646 22:32476892-32476914 TTCCTCCCACTTTAGAAAAAGGG - Intronic
1182759385 22:32709734-32709756 TTCTTTCCTTTTTACATAAATGG + Intronic
949116521 3:332465-332487 TACTACCCATTTTACAAAATAGG - Intronic
949197382 3:1328668-1328690 TACTTCTGATCTTAGATTAAAGG - Intronic
949294939 3:2510572-2510594 AACATTCCATTTTAGAAAAAGGG - Intronic
949500130 3:4671901-4671923 TACTTAAAATTTTATATAAATGG + Intronic
951023358 3:17804542-17804564 TTCTTGACATTTTATATAAATGG + Intronic
951705036 3:25535751-25535773 TATTTCCCATTTAAGAGACAAGG - Intronic
951831911 3:26939676-26939698 CACTTCCAATTTTAAATTAATGG - Intergenic
951926665 3:27915348-27915370 TATTTTCCATTTTTGAAAAATGG + Intergenic
953107104 3:39893388-39893410 AAATTTCCATTTTATATAAAGGG - Intronic
953497322 3:43399504-43399526 TTCTTCACATTTTAGAAACAAGG + Intronic
953703287 3:45213056-45213078 TTATTCCCATTTTACAGAAAAGG + Intergenic
953862802 3:46559621-46559643 TAGTTCCCATCTTAGAGGAATGG + Intronic
955607970 3:60726759-60726781 TTATTCCCATTTTATATAAGAGG + Intronic
956408911 3:68958239-68958261 TGCTTCCCATTTTAGTTGGAAGG + Intergenic
956535460 3:70271085-70271107 AACTTCCCAGCTTCGATAAATGG - Intergenic
956855165 3:73268929-73268951 TTCTTCCCATTTTAGAAATGAGG - Intergenic
959678224 3:109061698-109061720 TCCTTTCCATTTTAAAGAAATGG + Intronic
961933760 3:130561565-130561587 TAGTAACCATTTTAGATAATTGG + Intronic
963005896 3:140726036-140726058 TACTCCCCACTTTAAAGAAAAGG + Intergenic
963026235 3:140922262-140922284 TCCTTCCCCCATTAGATAAAAGG + Intergenic
963708661 3:148720881-148720903 TACTTCACAGTTTAGTGAAAAGG + Intronic
964215608 3:154277991-154278013 TACTCAACATTTTAGAAAAATGG + Intronic
964646720 3:158966543-158966565 TAATTCCCCTCTTAGAGAAAAGG + Intronic
967280167 3:187814725-187814747 TTCTTCCCATTTTATAGATAAGG + Intergenic
967290962 3:187919931-187919953 TTCTTCCCATTTTAGAGATGGGG + Intergenic
967617671 3:191591698-191591720 TTCTTCTCATTTTAGATACGAGG - Intergenic
969907212 4:10408369-10408391 TACTTCCTATTGTAAATCAAAGG + Intergenic
970346882 4:15160881-15160903 TAATCCCCATTTTATATATAAGG + Intergenic
970574841 4:17417108-17417130 TACTTGCCATTTTCTAGAAAGGG - Intergenic
971458800 4:26871977-26871999 TGCATCCCATTTTAGAGATAAGG - Intronic
971548088 4:27912955-27912977 TACTTCTCATTTTACACATAAGG + Intergenic
971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG + Intergenic
972247537 4:37261030-37261052 TATTTCCAATTTTAGAAATAAGG - Intronic
972992113 4:44833391-44833413 TACTTCCCATTTTACAGATGAGG - Intergenic
976000336 4:80366976-80366998 TACTGGACATTTTATATAAATGG - Intronic
976116897 4:81737703-81737725 TATTTCCCATTTTACAGATAAGG + Intronic
976338291 4:83916444-83916466 TCATTCCCACTCTAGATAAATGG + Intergenic
976891333 4:90051135-90051157 TACTTCGTATTTTAGAAAAAAGG + Intergenic
977545294 4:98369625-98369647 TACTTTGCATTTTATAGAAATGG - Intronic
978509676 4:109502790-109502812 TACTTCACAATATAGAGAAAGGG - Intronic
978901660 4:113957452-113957474 TATTTCCATTTTTAAATAAAAGG - Intronic
979171203 4:117602477-117602499 TACTTTCCACTTTAGATACCTGG - Intergenic
980851276 4:138385763-138385785 TTTTTCCTATTTTATATAAAGGG - Intergenic
981250294 4:142593184-142593206 TGCCTCACATTTTAAATAAATGG - Intronic
982152965 4:152483365-152483387 TGTTTCCCTTTTTAGATATATGG + Intronic
982437108 4:155392492-155392514 TATTTCCCATTTTGGATGCATGG + Intergenic
982906918 4:161086005-161086027 TACTTCACACTTGAGATAATAGG - Intergenic
984829677 4:183960677-183960699 TACGACTCATTATAGATAAAAGG - Intronic
985173680 4:187178206-187178228 AACTTCCCATTTTACAGAGAAGG + Intergenic
986165955 5:5271581-5271603 TACTTCTCAGTTTATCTAAATGG + Intronic
986516437 5:8569379-8569401 CACTTCCCATTATAAATGAAGGG + Intergenic
986862469 5:11943505-11943527 TTCTCCCCATTTCATATAAATGG - Intergenic
987515523 5:18902212-18902234 TAATTCCTATTTTAGAGATAAGG - Intergenic
988782113 5:34531873-34531895 TTCTTCACATTTTAGAGATACGG + Intergenic
988909007 5:35820872-35820894 AACTTCCCATTCTATATTAATGG + Intergenic
990002123 5:50906670-50906692 TTTTTCCCATTTCAGTTAAATGG - Intergenic
991446763 5:66708504-66708526 TACTTTCCTTTTTAAAGAAAAGG - Intronic
991904085 5:71490747-71490769 TACTTAGAATTTAAGATAAAAGG + Intronic
992144099 5:73827689-73827711 CAACTCCCATTTTAGAAAAATGG - Intronic
992669410 5:79043812-79043834 TACTTCCCATGCTACATAAGTGG - Intronic
992673057 5:79078792-79078814 TTCTTCCCAGTTTAGCAAAAAGG - Intronic
992718132 5:79531551-79531573 TGATTCCCTTTTTAAATAAAGGG - Intergenic
992736006 5:79722337-79722359 GACTTCACATGTTAGAAAAAGGG + Intronic
993225044 5:85158824-85158846 TATTTCCCTATTAAGATAAATGG - Intergenic
993309059 5:86305734-86305756 CAATGCCCATTTTAGAAAAAAGG + Intergenic
993642840 5:90426628-90426650 TACTTCCCATTTTAGTAAGAAGG - Intergenic
994959908 5:106586299-106586321 TACTTCTCTTTTTATTTAAAAGG - Intergenic
995128138 5:108600580-108600602 GACTTCCCATTTTTCATAAGAGG - Intergenic
995160117 5:108969436-108969458 TCCTACCCTTTTTATATAAAAGG - Intronic
995363120 5:111321634-111321656 AACTACCCATTTTAGATCACAGG - Intronic
996842597 5:127864200-127864222 GATTTCCCAATGTAGATAAATGG - Intergenic
997674764 5:135704687-135704709 TTATTCCCATTTTACAGAAAAGG + Intergenic
998380352 5:141720238-141720260 TTATTCCCATTTTACATATATGG - Intergenic
998551462 5:143081605-143081627 TTCTTCCCATTTTATAAACAAGG - Intronic
998736305 5:145145303-145145325 TACTTCCCTTTCTAGCTTAAGGG - Intergenic
998882709 5:146659838-146659860 AACTTCCAATTGTAGAAAAATGG + Intronic
998925447 5:147119241-147119263 TATTTCAGATTTTAGAGAAAAGG + Intergenic
998993387 5:147843916-147843938 TGCTTCCCACTTGAGGTAAAAGG + Intergenic
999058529 5:148608469-148608491 TACTTCCATTTTTCCATAAATGG - Intronic
999168505 5:149572285-149572307 TACATCCCATGTTACATAAGAGG - Intronic
999668402 5:153936708-153936730 TCCTTTGCATTTTAGCTAAAGGG + Intergenic
999686722 5:154109779-154109801 TAATTCCCATTTTACAGACAAGG + Intronic
999732124 5:154482695-154482717 TACTGCCCTATTTAGATAAGGGG - Intergenic
1000778221 5:165445280-165445302 GACTTGCTATTTTAGATAAGGGG - Intergenic
1000944611 5:167405380-167405402 TATTTCTCATTTTGCATAAATGG + Intronic
1001256105 5:170184454-170184476 TGCTTCCCATTTTACAGATAGGG - Intergenic
1001590553 5:172861549-172861571 TGCTTCCCATTTTACAAATAAGG - Intronic
1002652537 5:180711028-180711050 TCTTTCCCATCTTACATAAAAGG + Intergenic
1003309822 6:4960546-4960568 TCCTTGGCATTTTATATAAATGG - Intergenic
1003984940 6:11426100-11426122 TTCTTCCCATTAGAGAAAAAGGG - Intergenic
1005758435 6:28946305-28946327 TACTTCACATTTTATATATCTGG - Intergenic
1006672098 6:35735890-35735912 TACTTCCAAATTTAGCTGAAAGG + Intergenic
1007075186 6:39061731-39061753 TGCTTCCCATTTTACAGATAAGG + Intronic
1007231974 6:40354511-40354533 TAGTTCCCATTTTACAGACAAGG - Intergenic
1007676069 6:43596038-43596060 TACTTCATATTACAGATAAAAGG + Intronic
1007853325 6:44827020-44827042 TACTTCCAAATTTAGGTGAAGGG + Intronic
1008358293 6:50582931-50582953 TAGCTCACTTTTTAGATAAATGG + Intergenic
1008917545 6:56805719-56805741 TCATTCCCATTTCAGAGAAAAGG + Intronic
1008935954 6:56992569-56992591 AAATTGACATTTTAGATAAAAGG + Intronic
1009685996 6:66958580-66958602 TACTTCCAAGGTTAGAAAAATGG - Intergenic
1010071515 6:71750715-71750737 TACTTTCGATTTTAGATACCTGG - Intergenic
1010427346 6:75742118-75742140 TTATTCCCATTTTACGTAAAAGG - Intergenic
1011179303 6:84601649-84601671 GGATTCCCACTTTAGATAAATGG - Intergenic
1012109331 6:95207531-95207553 TACTTCCAATTTTATGTAAGAGG - Intergenic
1012532724 6:100257762-100257784 TTCTTCCGATTTGAGTTAAAAGG - Intergenic
1012604497 6:101141279-101141301 CACTTACCATTTTATATAATGGG + Intergenic
1013653040 6:112215693-112215715 TATTTCCCATTTTTAATGAATGG - Intronic
1014680152 6:124418434-124418456 TAGTTCCCATTTCAGAATAAGGG - Intronic
1014849315 6:126321760-126321782 TACTTTCTATTTTACACAAAAGG - Intergenic
1014973853 6:127853812-127853834 TTATTCCCATTTTACATGAAAGG + Intronic
1015354015 6:132255733-132255755 TTATTCCCATTTTACAGAAAAGG + Intergenic
1015904609 6:138103974-138103996 TACTTCCCAGTTTGGATTCAAGG + Intronic
1016692960 6:146959981-146960003 TTCTTCAAATTTTAGAGAAAAGG - Intergenic
1017064018 6:150512070-150512092 CCCTTCCCTTCTTAGATAAATGG - Intergenic
1017193462 6:151677330-151677352 TAATTCCCATTTTACAGAAAGGG - Intronic
1017544196 6:155433525-155433547 TAGTTCCCATTTTACAAAACAGG - Intronic
1021274893 7:18638351-18638373 TCCTGCCTAATTTAGATAAAGGG + Intronic
1022730851 7:33023862-33023884 TTTTTCCCATATTATATAAATGG - Intronic
1022940463 7:35232031-35232053 TACATACCATAATAGATAAAAGG + Intronic
1024347827 7:48330829-48330851 TTCTCCCCATCTTGGATAAATGG - Intronic
1026127588 7:67593151-67593173 TATTTCCCATTTTACAGAAGAGG - Intergenic
1027288638 7:76677533-76677555 TCCTTCCCACTTTAGACAAAGGG + Intergenic
1027400627 7:77802263-77802285 TACTACCCAATTTTGATAATTGG + Intronic
1027402439 7:77822624-77822646 GACTTCCCATTTCAGGGAAAAGG - Intronic
1028122692 7:87073909-87073931 TTATTCCCATTTTATACAAAGGG + Intergenic
1031044468 7:116872358-116872380 TTCTTCATATTTTAAATAAATGG + Intronic
1031061552 7:117056845-117056867 TATTTCCCTTTTTTGATAATTGG + Intronic
1031131976 7:117843383-117843405 GAGTTCCCATTTTAAATAGATGG + Intronic
1032404113 7:131643447-131643469 TACTCCACCTTTTAGAGAAAGGG + Intergenic
1032550976 7:132784004-132784026 TACATCCAACTTTAAATAAAAGG + Intergenic
1033806971 7:144965424-144965446 AACTTCCCATTTTATATACGGGG + Intergenic
1034346441 7:150388211-150388233 TAATTCCCATTTTACAAAAGAGG - Intronic
1034400974 7:150861174-150861196 TAGGTCCCATTGTAGCTAAAAGG - Exonic
1035869260 8:3119260-3119282 TATTTCCTATTTAAAATAAAAGG - Intronic
1037431329 8:18816291-18816313 TCATTCCCATTTTACAAAAAAGG + Intronic
1039348343 8:36732991-36733013 TAGTTCTCATTTTAGATACAAGG - Intergenic
1041506696 8:58607024-58607046 TGCTTCCTATTTTACTTAAAAGG - Intronic
1041958500 8:63583963-63583985 TATCTCCCATTTTACAGAAAAGG - Intergenic
1043569308 8:81584387-81584409 GACTTCCCATTATAGGTAAAAGG + Intergenic
1044638095 8:94347951-94347973 AACTTCCCAAATTTGATAAAAGG + Intergenic
1044864824 8:96560801-96560823 TATCTCTCTTTTTAGATAAAGGG - Intronic
1045083036 8:98649245-98649267 TACTTCAAATTACAGATAAATGG - Intronic
1045322730 8:101094205-101094227 TTCTGGCCATTTTATATAAATGG + Intergenic
1045678200 8:104631549-104631571 TAATTCCCATTTTATAGATAAGG + Intronic
1046258334 8:111730913-111730935 AACATCCCATTTTAGAGAAATGG + Intergenic
1047206964 8:122810261-122810283 TACCCCCCATTTTACAGAAAAGG - Intronic
1047957849 8:129988957-129988979 ACCTTCCCATTTTACAGAAATGG + Intronic
1048389865 8:133952456-133952478 TTCTTCCCATTTTACAAATAAGG - Intergenic
1051454105 9:17233622-17233644 TGTTTCCCATTTGAGGTAAAGGG - Intronic
1051522503 9:18004976-18004998 TACTTGTCATTATATATAAATGG - Intergenic
1052166635 9:25338873-25338895 GACTTCCCAATGTAGAGAAAGGG + Intergenic
1052750943 9:32490020-32490042 ACCTACCCATTTTAGAGAAAGGG + Intronic
1053627560 9:39890953-39890975 TTCTTCCCATGTTAGAAAAAAGG + Intergenic
1053778433 9:41575070-41575092 TTCTTCCCATGTTAGAAAAAAGG - Intergenic
1054216327 9:62359750-62359772 TTCTTCCCATGTTAGAAAAAAGG - Intergenic
1054671154 9:67795593-67795615 TTCTTCCCATGTTAGAAAAAAGG + Intergenic
1056273366 9:84968685-84968707 TACTTCTCATCTTAGTAAAATGG + Intronic
1058538782 9:105990899-105990921 TATTTCCCATTTTATAAAAGGGG + Intergenic
1058592216 9:106576918-106576940 TTGTTCCCATTTTAGACAAAAGG + Intergenic
1058731759 9:107857169-107857191 CACTTCCCATATTAGCAAAATGG + Intergenic
1059179938 9:112202092-112202114 TGCTTCCAATTGTAAATAAATGG + Intergenic
1060785624 9:126449854-126449876 CACTTCCCATTTTACAAATAAGG + Intronic
1062672654 9:137720603-137720625 TATTTCTGATTTTATATAAATGG + Intronic
1186211461 X:7254362-7254384 TACTTTCCTTTTTAAACAAAAGG - Intronic
1186350930 X:8738798-8738820 TCCTTCCCGTTTTATTTAAATGG - Intergenic
1187179013 X:16925622-16925644 TAACTCCCATTTTAGTTAAAGGG + Intergenic
1188047054 X:25438008-25438030 TTCTTCCCATTTTAGAGAAGAGG + Intergenic
1188127920 X:26393512-26393534 TACTTCTTATTTCAAATAAATGG - Intergenic
1188679529 X:32984574-32984596 TACTTCCCTTTTTATAGATAGGG - Intronic
1188929239 X:36085987-36086009 TTCATCCCTTTTTAGCTAAATGG - Intronic
1189126298 X:38450754-38450776 TATTTTCCATTTAAGAGAAAAGG - Intronic
1189617949 X:42803754-42803776 TCCTTTCCATTTTAAATAATAGG - Intergenic
1190561274 X:51687776-51687798 GACTTCCCACTTTACATGAATGG + Intergenic
1190563017 X:51705541-51705563 GACTTCCCACTTTACATGAATGG - Intergenic
1190979451 X:55443163-55443185 TATTTCCCATTTGAGAAAATGGG + Intergenic
1191803837 X:65111930-65111952 TATTTCTCACTTTAGATCAAAGG + Intergenic
1192597841 X:72430150-72430172 TTCCTCTCATTTTAGAGAAAGGG + Intronic
1193368433 X:80662731-80662753 TACTTTCCTTTTAAGATCAAGGG - Intergenic
1194643613 X:96431401-96431423 TTATTCCCATTTTATAGAAAAGG - Intergenic
1195321135 X:103723000-103723022 TAATTCCCATTTTACAGAAGGGG - Intronic
1195667231 X:107442428-107442450 TAATTCCCATTTTATAGATAAGG - Intergenic
1196465951 X:115971560-115971582 TTCTGGCCATTTTATATAAATGG - Intergenic
1196535848 X:116843128-116843150 TATTTCCCACTTTAGAGATAAGG - Intergenic
1197294667 X:124704042-124704064 TTATTCTCATTTTAGATAAATGG + Intronic
1198153337 X:133932914-133932936 TAATTCACATTTTAAATATAAGG - Intronic
1198951644 X:142078908-142078930 TACTTTCCAGTTTGGACAAAAGG + Intergenic
1199031958 X:143011515-143011537 TACTTCTCAAATGAGATAAAAGG - Intergenic
1199507578 X:148583023-148583045 TTCTGCACATTTTACATAAATGG - Intronic