ID: 1095146238

View in Genome Browser
Species Human (GRCh38)
Location 12:38730946-38730968
Sequence GTGTCTTCTCAGTTTAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095146234_1095146238 6 Left 1095146234 12:38730917-38730939 CCTTGAAGTAATCATCACTACCT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1095146238 12:38730946-38730968 GTGTCTTCTCAGTTTAGGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095146238 Original CRISPR GTGTCTTCTCAGTTTAGGTG AGG Intronic
900550600 1:3252558-3252580 GTGGCTTCTTAGATAAGGTGGGG - Intronic
901799926 1:11702338-11702360 GTGTGTTGTCAGTGTATGTGTGG - Intronic
904719531 1:32497668-32497690 GGGTGTTCTCAGTACAGGTGTGG + Intronic
906041113 1:42788397-42788419 GGGGCTTCTCAGTTTTGGGGAGG + Intronic
907795726 1:57714742-57714764 GTTTATTCTCAGTTTAAGGGAGG + Intronic
907952779 1:59199890-59199912 GTGTCTGCTCAGTGTAGTGGAGG + Intergenic
909235494 1:73148215-73148237 GTCTCTTCTGAGGTTAAGTGTGG + Intergenic
912004994 1:104887270-104887292 GTGTATTCTCAGTTGAGGACGGG + Intergenic
912573425 1:110642062-110642084 GTGTTTACTGAGTTTGGGTGTGG - Intergenic
913747824 1:121926621-121926643 ATGTCCTCTCAGTTATGGTGAGG + Intergenic
914909796 1:151775638-151775660 GTGTCTTCTCTGGTTGGGTTGGG + Intronic
919247275 1:195004540-195004562 GTGACTGCTCAGTGGAGGTGAGG - Intergenic
920726020 1:208435948-208435970 GTGCCTCCCCAGTTTGGGTGAGG + Intergenic
923626991 1:235622233-235622255 GTGTGTTGTTAGATTAGGTGAGG + Intronic
924351930 1:243123150-243123172 TTGTCTTCTATGTTTAGGTAAGG - Intergenic
1065035379 10:21633391-21633413 GTGTATTCCCAGTTTTGGTTAGG + Intronic
1065284227 10:24171991-24172013 GTTTCTTCTCTGTTTAAATGGGG - Intronic
1065481705 10:26201042-26201064 GATTCGTTTCAGTTTAGGTGTGG + Intronic
1065636495 10:27741380-27741402 GTATCTTCTCGGTCTTGGTGGGG + Exonic
1065743781 10:28820183-28820205 GAGTCTTCTCTGTGTCGGTGTGG + Intergenic
1067437877 10:46291770-46291792 GTGGCTGATCAGGTTAGGTGGGG - Intronic
1068542130 10:58306720-58306742 TTGTCTTCACAGTTTTGGGGAGG - Intergenic
1069109877 10:64434103-64434125 GTGTTCTCTCTGGTTAGGTGAGG - Intergenic
1070839977 10:79478565-79478587 ATGTCTTTTCAGTTTATTTGTGG - Intergenic
1072988696 10:100168179-100168201 GTGTGTTTGCAGTATAGGTGGGG - Intronic
1073760026 10:106619307-106619329 GTCTCTTTTCAGTTTAGTTATGG + Intronic
1075406954 10:122201413-122201435 CTGTCTTCTCAGTGTAGATGTGG - Intronic
1076166312 10:128285297-128285319 GTGGCTGCTCAGGTCAGGTGGGG + Intergenic
1078379306 11:10825722-10825744 GCATATTCTCAGTTTGGGTGTGG - Intronic
1080188616 11:29520590-29520612 GTGTCTTCTCCGTGTAGGAGGGG - Intergenic
1082961106 11:58919589-58919611 GTTTCTTCTCTGTCTGGGTGGGG + Intronic
1083625473 11:64069900-64069922 GTGCCTTCTCAGTTGAGGTCTGG - Intronic
1084010526 11:66346019-66346041 CTGACTTCTCAGATTAGGGGAGG + Exonic
1084962127 11:72722409-72722431 GTCTCTTCCCAGCTTGGGTGGGG - Intronic
1087171014 11:95050328-95050350 GTGGCTTCACAGTGTAGCTGTGG + Intergenic
1089366736 11:117925178-117925200 CGGTCTTCTCTGTTGAGGTGGGG - Intronic
1089766414 11:120770338-120770360 GTGACTTCCCAGTTTTGCTGAGG - Intronic
1091541304 12:1465173-1465195 TTTTCTTCTCAGCTTAGTTGGGG - Intronic
1093458215 12:19385073-19385095 CTGTCTTCTCAGTTTTGTTTTGG + Intergenic
1095146238 12:38730946-38730968 GTGTCTTCTCAGTTTAGGTGAGG + Intronic
1095442063 12:42247314-42247336 GTGTCTCCTCATTTTAGGGGAGG - Intronic
1096404111 12:51330436-51330458 GTATCTTCCCATTTTATGTGTGG - Intronic
1098354404 12:69597621-69597643 GTGTCTTTTAATTTTAGGTGAGG + Exonic
1101800564 12:108018152-108018174 TTGTCTTCTTAGTTAGGGTGGGG + Intergenic
1103169517 12:118803593-118803615 GTATATTCTGAGTTTAGGGGTGG + Intergenic
1104168100 12:126253461-126253483 GTATCTTCTCAATTTTGCTGTGG + Intergenic
1108102559 13:46972509-46972531 GTGGCTTCTCATTTTAGGAACGG + Intergenic
1110565360 13:76952250-76952272 TTATCTTCTCAGTTGAGTTGAGG - Intronic
1111611682 13:90614855-90614877 GGGTCACCTCAGTATAGGTGAGG + Intergenic
1114783917 14:25571885-25571907 CTGTTTTCTCAGTTTAAGTTTGG + Intergenic
1115931467 14:38501365-38501387 TTTTCTTCTAACTTTAGGTGTGG + Intergenic
1115945939 14:38660694-38660716 GTGTATTCATAGTTTAGGAGGGG - Intergenic
1116160606 14:41263099-41263121 GTGTCTTTTCAGTATAATTGAGG + Intergenic
1116281325 14:42912694-42912716 ATGGCTTCTCATTTTAGGTTAGG + Intergenic
1118964459 14:70567161-70567183 CTGTCATCTCAGTTTGGGTCAGG - Intergenic
1119184704 14:72631855-72631877 TTGTCATCTCAGTCTAGGTTAGG - Intronic
1119529534 14:75350057-75350079 GTTTGTTTTCAGTTTAGGGGAGG - Intergenic
1121646120 14:95517726-95517748 CAGTCATCACAGTTTAGGTGCGG + Exonic
1124648440 15:31457006-31457028 GTGTCTGGCCAGTTTTGGTGTGG + Intergenic
1127272106 15:57410874-57410896 GTGTCTTGTCAGATTCAGTGGGG + Intronic
1133817418 16:9208820-9208842 ATGTCTTTTCAGGTCAGGTGTGG + Intergenic
1135342042 16:21657183-21657205 GTGTTTTCTCTGTTTTGGGGGGG - Exonic
1135653328 16:24226046-24226068 ATGTCTTCTCTGTTTATGAGAGG - Intergenic
1140690166 16:77475256-77475278 GTGTGTTCTGAGTTTAGCCGTGG - Intergenic
1143647976 17:8244257-8244279 TTGTCTTTTCAGCTAAGGTGTGG + Intronic
1147012965 17:37466515-37466537 GTGGCTTCTAAGTTTAGTTCTGG + Intronic
1150067583 17:62124519-62124541 GTGACCTCTCAGCCTAGGTGTGG - Intergenic
1152358889 17:79820958-79820980 GAATCTTCTCATTATAGGTGTGG + Intergenic
1152606113 17:81291307-81291329 GTGTGTTTTCAGTAGAGGTGGGG - Intronic
1154108699 18:11547743-11547765 GTGCCTTTTCTGTTTGGGTGGGG + Intergenic
1155434901 18:25802102-25802124 GTGTCTTTTAAGTTCAGATGAGG + Intergenic
1155837685 18:30607165-30607187 GTCTCTTCTCTATTTAGGTATGG + Intergenic
1156457151 18:37301266-37301288 GTGGCCTCTCAGTCTAGCTGAGG - Intronic
1156481957 18:37441884-37441906 GGGTCTTTGCAGTTCAGGTGTGG - Intronic
1157831109 18:50857807-50857829 GTGGCTTCTCTGTTGAGGGGAGG - Intergenic
1159025961 18:63182401-63182423 GTGTTTTCTCAGTACAGATGTGG - Intronic
1166283481 19:41810022-41810044 GTGTCCTCTCAGCCCAGGTGTGG + Intronic
1166785801 19:45366007-45366029 TTGTCTTCTTAGTTGAGATGAGG + Intronic
925392372 2:3505309-3505331 GTTTCTGCTCTGGTTAGGTGTGG - Intronic
925921252 2:8639338-8639360 CTGTCTGCTCAGTGCAGGTGAGG + Intergenic
927825126 2:26303207-26303229 GTGTCTTTTTAGTTCCGGTGGGG - Intergenic
928689433 2:33783803-33783825 GATTTTTCTCAGTTTTGGTGAGG - Intergenic
929454804 2:42058126-42058148 GTGTTCTCTCAGCTTAGGTCTGG + Exonic
931863171 2:66378720-66378742 CTGTGCTCTCAGTTTAGGCGAGG + Intergenic
934120714 2:88836487-88836509 GTGTATTCTCAGTGTCTGTGAGG + Intergenic
938220562 2:129562660-129562682 GTGTCTTCATAGTTAAGGTGTGG + Intergenic
939482043 2:142761658-142761680 ATGTAGTGTCAGTTTAGGTGGGG - Intergenic
940443244 2:153744861-153744883 GTATCTTCCCAGGTGAGGTGAGG + Intergenic
944662532 2:201933226-201933248 GTGTGTTCTGAGTGCAGGTGGGG - Intergenic
945381959 2:209150838-209150860 GTGTCTTCTCCTCTCAGGTGTGG - Intergenic
945727870 2:213495093-213495115 GTGTTTTCCTAGTTTATGTGTGG + Intronic
1174093145 20:48065980-48066002 TTTTCTTCTCAGTGAAGGTGGGG - Intergenic
1174792854 20:53496622-53496644 GTGACTTCTCAGGTTGGCTGGGG - Intergenic
1176094183 20:63332422-63332444 GAGCCTTCTCAGTTCAGCTGGGG - Intronic
1178476608 21:32942885-32942907 GTGAGTTCTCAGTTTCTGTGAGG - Intergenic
1185270035 22:49925400-49925422 GAGTCTTTTCATTTTAGATGTGG + Exonic
950466483 3:13158367-13158389 GTGTGTTCTCATTTTGGGTTTGG + Intergenic
951891392 3:27571078-27571100 GTTTCTTCTCAGTTCAGGTGTGG - Intergenic
952401790 3:32970029-32970051 GTGCCTTCTCTGTCCAGGTGGGG - Intergenic
952504132 3:33992251-33992273 GGTTCTTCTCAGTTTAGTTTGGG + Intergenic
953002501 3:38948696-38948718 GTGTCTTCTTATTTAAAGTGAGG + Intronic
953051626 3:39349471-39349493 GTGCCTTCTCTGTCCAGGTGGGG - Intergenic
953239219 3:41133710-41133732 GTGGTTTCTCACTTTAAGTGGGG - Intergenic
953425742 3:42796188-42796210 GAGTCTTCTCAATGAAGGTGAGG - Intronic
954995826 3:54880784-54880806 CTCTCTGCACAGTTTAGGTGTGG + Exonic
955370589 3:58348080-58348102 GTGTCTTTTCAGTAGAGGTGGGG + Intronic
959933968 3:112011116-112011138 GCATCTTCTCAGTTTAGGACAGG + Intronic
959961829 3:112306293-112306315 GTGCCTTCTCTGTCTGGGTGGGG - Intergenic
965466109 3:169032565-169032587 GTGTCTTTTTAGTTGAGATGGGG + Intergenic
967540240 3:190658598-190658620 GTGACTTCTCATGTAAGGTGTGG - Intergenic
968841943 4:3013935-3013957 TTGTTTTCTGAGTTTATGTGGGG + Intronic
971250549 4:24970220-24970242 CGGTCATCTCAGTGTAGGTGTGG - Intronic
974090709 4:57307826-57307848 ATGTGTTCTCATTTTAGGTTTGG - Intergenic
975468784 4:74739736-74739758 GAGTCTTCTTAATTTTGGTGTGG - Intergenic
982268881 4:153566748-153566770 GTTTTTTCTAAGTTTATGTGTGG + Intronic
982565486 4:156980613-156980635 TTGTTTCCTCAGTTTAGGTAAGG - Intergenic
983635430 4:169893172-169893194 GTGTCCTCTCAGCTCTGGTGTGG + Intergenic
983854756 4:172630186-172630208 ATGTTTTCTCTTTTTAGGTGTGG - Intronic
986245653 5:6004310-6004332 GTGTCCTCTGAATTTAGATGAGG - Intergenic
988885298 5:35550663-35550685 CTGTGTTCAAAGTTTAGGTGTGG - Intergenic
989607317 5:43256966-43256988 GTGTCGTCTTAGTTTGGGTTCGG - Intronic
990052985 5:51531068-51531090 GTGTCTTATCAGTTGGGGTTGGG - Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
996906165 5:128603112-128603134 TTGTCTTCTAAGTTAAGGTTTGG + Intronic
997449663 5:133971641-133971663 CTGTCTTCTCATTTTATCTGGGG - Intergenic
1000256960 5:159548592-159548614 GTGTCTTCTCATTCTAGGTCTGG + Intergenic
1000430973 5:161152158-161152180 GTCTCTTCTCATTGGAGGTGAGG - Intergenic
1001650241 5:173310812-173310834 GTGCCTTCTCAGAGTAAGTGGGG - Intergenic
1004813165 6:19282105-19282127 CTGCCTTCTCAGCTTAAGTGAGG + Intergenic
1008698058 6:54064716-54064738 GTTACTTCTGAGTTTAGGTTTGG + Intronic
1008868650 6:56246571-56246593 GTGTCTTCTCTGATTAAGTAAGG + Intronic
1012536906 6:100309596-100309618 GTGTGTTCTCAGTTTAAAAGTGG + Intergenic
1014015196 6:116521595-116521617 GTGCCTGCCCAGGTTAGGTGAGG + Exonic
1015115946 6:129649741-129649763 TTGTCTTCTCAGTTTTGCTTAGG - Intronic
1016496402 6:144667432-144667454 TTGTCTTGTGATTTTAGGTGTGG + Intronic
1018165302 6:161088478-161088500 GTGTATACTCAGTTCTGGTGAGG - Intronic
1018895167 6:168010993-168011015 GTCTCTTTACAGTTGAGGTGAGG + Intronic
1022606606 7:31821717-31821739 GTGGCTGCTCATTTCAGGTGAGG - Intronic
1022969095 7:35500433-35500455 GTCTCTTCTCAGGCTAGGAGCGG - Intergenic
1023320122 7:38987770-38987792 CTGTCTTCTTAGTATATGTGAGG - Intronic
1029337637 7:99915858-99915880 AAGTCTTCTCAGATTAGTTGTGG + Intronic
1030422208 7:109321716-109321738 GTGTCTGTACATTTTAGGTGGGG - Intergenic
1030854903 7:114543257-114543279 TTGTATTCTCTGTTTAGATGAGG + Intronic
1031667703 7:124505013-124505035 GTGTCTTCCCAGTGTACTTGTGG - Intergenic
1035342351 7:158171685-158171707 GTTTCTCCTCAGTTGAGATGTGG - Intronic
1036201326 8:6773668-6773690 GTGTCAGCTCCATTTAGGTGAGG + Intergenic
1036722863 8:11193236-11193258 TTGTCTTCTTAGTTTAAATGAGG - Intronic
1040797617 8:51303238-51303260 GTGTGTGCACAGTCTAGGTGTGG - Intergenic
1042238079 8:66635737-66635759 GTGTATTCTCAGTAGAGTTGGGG - Intronic
1044163331 8:88948522-88948544 GTGTCTTCTCAGTATATTTGGGG + Intergenic
1044510581 8:93073806-93073828 TTGTCTTCTCAGTATATGTCTGG - Intergenic
1045545597 8:103125485-103125507 GAGTCTTCTCGGCTTAGGTTGGG + Intergenic
1050095260 9:2058125-2058147 GTGTCTCTGCAGTTAAGGTGTGG - Intronic
1056280046 9:85032361-85032383 TTGTCTTCTAACTTTAAGTGAGG + Intergenic
1059250883 9:112887027-112887049 GTGCCTTCTCAGTCTTTGTGTGG + Intronic
1061027786 9:128061689-128061711 GCGTCTTCTCTTTTTAGCTGAGG + Exonic
1188954197 X:36414899-36414921 TTCTCTTCTCAGTTTTGTTGTGG + Intergenic
1189700469 X:43713568-43713590 ATGTCTTATTAGTTTATGTGGGG + Intronic
1192940804 X:75909782-75909804 GTGCCTACTCAGATTAAGTGTGG - Intergenic
1194666802 X:96684999-96685021 GTGCTTTCTCAGTTGAGGAGAGG + Exonic
1196344470 X:114636953-114636975 GTTTCCTCTCACTTTTGGTGTGG + Intronic